%PDF-1.6 % 17313 0 obj <>stream h{]-ˑ_Y] c!ЃF> 6 ];YQ6{m 8{ꪈz^U~W_U׊U>¿U_uW~+kܯ+>aJ]z۫ל%^^kC0Ucc(n wB*jGzmD:pn3xc??笯V xg8/0kb<^ϼק6kyf@EΑd<{v 0pͧrBuO|ݟxq*0*_[pjx~s mΤ71$Y6ŏ|~|P@W*qps *_ ~RLr&)"[3/n.%4LgAEa("Fr` u|ܜPV++ni1zolq`#\T.o 8Ã+g / Rz6&ipwL21yW$LtCY׈#@\->8kT1ITʕ%hoD:҂+k$9 69maH\&r˪ ˯q 9KaBF[\J 1ظ6dP|uWR«nK55;)wj0aG~}uGtFu^|DWj,1q`a.Z|01#;Ef5>.L†`'xsU;:^,pH8+ |6.JA9*=x}yqssmĚAMPN[tڰ|J @d.&(`b#}QV0_j0[ko ;901"$RZuP3ĀC"2:T mr8@-Swq7..HC:f5gSqɠKq)4(҃W|B0o?UOx~9xCoQ<4op ̼?_On# _ao}??OoO_W,`O?o|ozDX~?30ďwGs0Qx} Ģ}3$X.gۿ^_v#>]}9}dž`~!6K++VVX_qhдiKCӊHH="fӪH}v}g߰ǿ_t'eGyϏjFkcw. yiDߡ+\my6ѼOfp޼oM~`7r缙Z{\7,~?'`4,Ix0gfH~ii,`򎆕LffIuw,d4"DYk(&#9ofbKuX53:XLXO'-]l6-kĘ3sJ9K9S1gf L5ä)U43 f&ƜnM*&&Дd"ʯm1 4f.ʊg1g}ٍ1g.*^y1g.j̦ic̙+;SRXMm(&ƘshK2SȘ)-dL:Ƙ3 C>S03C>S0sjS4S@Ș`dT02fj#3%?S(13EG2f"3?e3E b]T#DL#c1SȘ)td:2fj^J RMbV ^JiY)-x1+/f%/|.I^;>/ZSNmd(-SjF>@W*1VJ~taWJbX)]W"ĕ҅xVr$څ`Vj qt!!B\k%#VR:|YC4Ik%#+'#ĕWr%3D+)1.mxE+)1tĸsW2:]J+WD+)KJJG+)a)ڰdtJF+ѯjDJ\ru\!jDR5-\x\'Yx\GY ĕ\ B\ ĕ\'^aMr5I$jbr5 1\_x\_x\G)NPL1;s dC1;)C1;)}~t~NJG4c\ve'a\vR ;Nle'D7YU Iԏ ɗl18>[`nB+[ɲȌ"Jt!YIV/`W7ǫ iMX c+ogo VSbE[ ;VSdH[9;fVSfBW6,YT~3Cñ*ߔSO](U(%ŇTR|؃Q*)>1*)>8+)>l+)>R|ؐVR|N'`O08-L%g|o*,JJI9)>0ŧ1vƕӒs.C.sS|:KaQR|Nwc<%l[Qt{zdZQR|G%g.ayDIaQR|Nwnfb0<$%3(#J2|<71[Q߲<$3(CRGa%yyDIfQG$a%9yDI fQG$`e[J/<$"-(Iۡ%yDIeQvGd]e}*oh_ϭp)¥,/ N옫e\`1;bLvdg]@vuSgʶ. ;bߴLv #R;bL}ԫǎ H_>vdG_7 ȎJ-vd`@vVj#0 !Mgjc0 ;+AQX€0 NJyJ ;+5H35P NJ ;+5\ ƀt2Vj1 ;ñR쀬f'd7 :$;ҙ*ea`R&ea`R&ea`R&e9ۦ35 $-tJYL00) 00) ,ԙ*i!ә*ea`R&ea`R&ea`RcxLgL]mx7}DgƗՙ*1!R/aKX%,z K^R/a.,z K^%,q K\%,%,q K\%,q K\%,%,q K\%,q K\%,%,q K\%,q K\%,%,q K\%,q K\%,%,q K+炟XmYz U[JV-Ma7@vzd7%NpJxc-vd8ukz-[ 衷Coe`)tB3cۭNoE9BrmuCo)+RV[8z-e[ʡCoۥOR8,EoM0Q5Ђ\{ձK˥t5pKKY!~Ut RU5h`~6ǜV_EC:eFWmxI<߲O1PQW[ q  q  q  q  q  qk^!n+ĭy5֬BܚW[ qk^!n+ĭ{uֽBܺW[ qV!n+ĭ{u6B܆W q^!n+mx 6BܦW q^!n+mzM6BܦU q[^!n+my-ⶼBܖW q[^!n*m{mⶽBܶW q^!n+m{m* qB+ qB+ q/^!֪[z q/^!+Ľx^B܋W{ q^! 7^BܫW{*Ľz07z0? X[_z=/*\{1F:]~ܭ1Zc/hM_Ѻ}1F}Q{s1Zl_QƮjc?űuOy:>A ٵDvmk]Ƥ} CjGtk5 Gc} cѾԾO} Ӿi_a`Ӭ@nfAmyD׾i_ﴯa`00k5 L} SS5 L} Ӿi_s-00k5 L6^FP,#F8wؖG#ŇyP{AX1]]]Gc#yH6f1GbCe222,mf2j3ːSY2f!ٴ,Cvmfk3ːaY2df!6 eȵ,Cmf2n/.2f!6 yeȼ,Cmfo3ːY 2f!Ӷ,C&nfrq3ːY|2df!'7 Ye,Cfnfs %2ːY<2df!W7 ٺe,ㇳ3Y]˺|tiSx!2d?Y'ːd,Ce~ OYz²42=X,c=ӳ,2ֳ=X,cY*ճ 3S;0NY48u,|yyaqJƩf8q1Dy48㼏JQTHsS"CN49c o+Zx[gJLNm%&g,m%'S4o+UH5o+S3m%,g`J[^nr_^\Ny;330930933093097]yο#xN49Э@7f=7|g^79{_s;O1o&t6ο:^7:^eS9eZrk^7:^7:^7:V{):Su*:y::ض:TN9٩S9~u~33mujM:Ў UehDŽfh"Wsw"WsObujvVT2OV_eh Xp#og`~30XSH9틁eX዁og`3d޾X2f`IěLߵ_9.圗rK9?Lw/LT+E㟊)'`5 SNf M9)'4\۔>ҰF"($b'd6SNn 8L9SuQN9x[rTƨCuQϗSuQN9*c)C`:ƨC`:eu~@0Frc)G0Frc)G0Fr:hQ1ꐣ1Fr4h^^(@V5U jU jdU fZ܌RQjq3J-nF(7fZ܌RQjq3J-nF(7fŽRQjq3J-nF(7fZ܌RQjq3J-fF(7fZ܌RQjq3J-nF(3fZ܌RQjq3J-nFU jdU bfYȪ@V5U jdU .G U jdU YȪ@V5U jq#U T5U jdU YȪȪ@V5.#ǀ|ܧ\@r2#]%,r K\R\X%,r K^R/aKX%,R/aKX%,z K^R/aTz K^R/aKX%,z KKX%,z K^R/ajP@x>~-˿jCC`EC +ف]YW uYW u`YW uZȺZ/>}˿o_?/Q}?/}L_cۗ||V_3|fv_sӗ\__՗ __ݖ忖/}Ǘ.w忭ȺZȉb[W uYW (˺ZȺZȺZȺZⱮ j_ZW uYW uYW uYW uFuYW uYW uYW uYW uGXW uYW gc?,GXY_g}ExY_4yͳhE/e}63affffdmd`620fffi3fp~M7    LF A5l00mf  UfSS!ͦ f̀̀\snvLbemD!2e.>2e.>2e.>2e.>2e.>2e.>2e.>2e.>\|dw\|dG~G~Gv` kv` kZq)Y_VJbäd@vfΒ:Ü%@,2g 9KYd sY` sYd sȜ%@,2g 9K,0gIݜ%@,2g 9KYd sȜ%@r9Yd sȜ%@,.%cR2KťdV.%R2Kɜ.%sLwΒY2;KffƲ t.@t?L?/Ij#NW8Ru#Tq|7F&?6G6: Q1X 0XDhceCX6V&?8u10u10u10uĝ588iceCX6ZRGSGSGSGܹ0Xc`*BX*8jjj}6V ic6V icך 6ZZZZZZyTf+UJUaR5V]j?n_4綺^w\_??e\TqiWSƥm5Opi_}~ ՜pB,c_|=|XtgCPj}5K=lz0%ajaCm Lj}5}5Ӿ6Lm9lr0尡6Pj}5WQ16Ww06ܩ-dÝB6ܩ-dí526W#}5Ӿi_5S[Ȇ;lS[Ȇ;l&Ɔ[j}5Ӿi_f`-dCy:Ɇt $nmf`e30v Ll]6.o~|p?&(e30v Ll]6.p?S[ߩ-܏om Ƿv Ll]600X,;Nq{-1!Ө} ˾e;a=l}_4gNI{U|9vF~2jWMɞ^5˫&{yd/UjWM^WM^5۫&{{doUjWM> UMyjcU YȪ&@V5 UMjO UMjdU YȪ&@V5 UMZV5 UMjdU YȪ&@V5'j$ PH?Tb`vs-GX&,kb-5 >P >Д- >Ж# ,',u1(@u >АM >Вm ~<e`Cl%@C4%@K%l, LX&aa,VOH˗%-&-@&-@&-IZLZLZqi2i2i2i2i2i2i2iKZ%-咖rIK\R.i)KZKK\R.i)KZ%-咖rIK\R\Z%-咖rIK\R.i)KZ%-咖R.i)KZ%-咖rIK\R.i)ҌK3 ->A[_V'7*iXO߁۪iQUT×6oS}~_g-md6 EVkZڀZڀd6 Y-ʴZڀd6 0t~qn8? ՜Ww~Tt~\qm8?ݜww~Q~q[-c6 Y jm@VkZڀZڢY jm@VkZڀd6 Z jm@VkZڀd6 Y jmQBN`6 Y jm@VkZڀdjm@X jm@VkZڀd6 EVkZPOhؗUmjPw Җ|wU;LKM%;\k%') /,uU eUR*>..>..]K]KwwN.݉ߥ;t'~;NN;N[wwNn݉f |s'_~ L+nݡ㯻S_<:gW_lÍ>C*H#)}u.9\ܹ$ sʚ  r\Me{7eddwd7d#o \`wi7MNn`Y16k0f ج5#o B`wi1n`&{5ccl`Y16k0F@rc47M0^ f ج5ccl`OuθiZPθiPG`gl־4Ys2f 7M0Mqc`Y!vf جy 쌛& ثǀ09 qc81a;qv<x 7qc09 ޝs@;>qc3nLxƍ ϸ13n81as@^~0g6~v 66666666S         +Ms8s6s6s6s6s6s6s99999999999윍윏윏윏윏윏윏윏윏윏kvGvGvGvGvGvGvGvGvGvGv5;#;#;#;#;#;#;#;#;#;#;皝seeeeeeeeeeƲ}IJ}IJ}IJ}IJ}IJ}IJ}IJ}IJ}IJ}IJ]c>b>b>b>b>b>b>b>b>b>b{,?P^bտ\>b# l'D"[ -|Bd >!Pq"4Nق$[`l1#[`lf Hv-Bm!M- il1(P) b il1#[W1!M-0Fc&WHd -0Fcd! k4A@l!M-0Fcd -0F#[`q4Acd -0Fcd ޏlf H cd -0Fcd -0Fݛ- M.& #[`l1#[`l~igp[mi˃ b%Zb%Zb%Zb%Zb%-1-1-1-1-1-hɁhɁhɁhɁhɁhIEK@K@K@K@K@K*Zr%Zr%Zr%Zr%Zr%ZRђ-9В-9В-9В-9В-9ВhɁhɁhɁhɁhɁT@K@K@K@K@Kjےs39łXRS&ZPG xrO->b OP'B(!4vl&g3Ӥ'GY0F&c 0F(XCoL x3+̈́7Q ?! jzYKmR]!. x)c/,ूTL1B#`lI.It)MAA&'%d^JfץdJ\JyeY[JdY[JdY[J-!R-%lY֖em)Y֖em)Y֞g˲,kKqY[BdY{#R-%R[ ?sA?yR w}nG ?ky] ,kKqY{em)Y֖em)Y֖em)Y֖em)Y֖em)Y֞ǹ-!R-%R-%R-%R-%,kKqY[BdY[JdY[JdY[JdY{em)Y֖Ⲷ,kKɲ,kKɲ,kKɲ,kj6%Hp|Y J^ϑYϕYeyR--gmy,%gmy<#e)y,%HYB)K#e)y,%䑲>R#H>R+#H>R#2}\r>R -H#m`i 7 j܀`q -H#m`i 7 j܀`q -H#m`i 7 j܀`q MN{`od ]A+prJͥؐoXބ. c]yƺ&uM뺛0e7anX݄p0x`9(!ӊR2(hyZށwhyZށwU-@;-@;-@˫hyZށwhyZށwhyZށW-@;-@;-hyZށwhyZށwhyZ^E;-@;򲓁`¤đ?GտܥiЂ'-8'btv\~8L0^BOG5<_<<`);⑞0Fz c'0FzXa< yS0Fx~?gJAHO#=%=j # ^< ^sCP*1HO[y򀱆'(x%+c:c4@v PENb{EۘAMdAMd4XPlo6XPloe?Rlo6YPlo+M6Ybd^Ҵ6Xb`m+ 6Xbdm+M6Ybd^ĵ6Xb`A 5XPlbkM[kZ֚,(d~,Z,(`A 5XPlɂbkM[kZ֚,7[kZ,(`A<@)GyQB>J_+3_;3_l~5bhmmFhmFhFhFhFڑhFhFh]Fh]Fh]Fh]Fh]Fi4Lf4hF#4iH3FI4L4hF#5iHsFk4\4hF#-4iH FZh4BhF#-4i)HKFZj4RhF#-5iHKFH$F#h?Gh4FH4K4K4K4K4K4MK `7a,&'Kn],xaK.%e懲`wEĻ"X{g0g`_.{^ߺ{^<->->->-hhhhhhqE@@@@@+Z|Z|Z|Z|Z|Z\->->->->->hhhhhP@K @K @K @K @K %Zb%Zb%Zb%Z╡K?](Q%^īCxHǫCxu]աKl֡KlĖKl֡Kl֡Kl֡KѡKѡKѡKѡKѡK\աK\աK\ĕK\աK\աK]tC0%L.a2t ӡK]tCp%\.:t סK]eCpD%B.:tСK]"tCD%B.:tԡK]"u0(9ޏQrk|EYdZRQjKNF yd??=G@(yd X,?{ u'ϕʤ'4DK) E!nPYBlg8y c1Xo`A! q6XP;RɂBMI,&x cMd8,(`A! q6Y*&8,(ɓXM,&ƚ,x q6XPB lg~R'0ƛXM,5Yc d`,(`A!& q6YPɂB<1oba}B lg8,(dA!& q$$9&Bf` q+!IÕ+LIrdh#S$G&925ɑILMrdj#Suy#IR(%IR| -'|*'|(A߇X?7Ce˄*!P)iJI3TJR f4Cy*%PWIO$_f4Cϖf4C*%P)5 f4C*%}4C*%P)iJI3TJ$4C*%P)is*%P)iJI3TJR ?+P)iJI3tf4C*%P)iJI3TJRZ*LR ǥ*%P)iJI3TJR f4Cl4C iJI3TJR f4C*%P)iJi MiJI3TJR fĪqbUʹ )\J.CzfJ9Rjû).eʸ RKTÕ+؋A*KK%_ڗܲ/ydk_־ {d{#_/ž~,ȗ;Sس#_`|181`pa"_`|1?Gc /0qc D{c /0FU#_`|1`?#` Rس#_`|1&c qcS|1#_`|1ȗ\س81`XžEc /0Fc~)Y {c /0Fc /e/%` %_ˆra} v{^v.0E7akn?S3/+2KKg),%7泔|޽o>Kg),%7泔|RrYJn>>rYj 6Ct1H\8I#]`chZ16c .0F|¡MC 01c mH#]`t1IC 01c 6c .0Fc ށchZ1…Ct1H#]`t1Z1c -¡MCPK8tHCt1+:p4^C@p.0Fc .0FX?ЃC,8tCg0= #:V:EϏtGc$#qx̃Ϗx¡C}gc .0H1cp/&: .0FH#]`t1F`8kCxp!]`t1H c 1cX: Dc .0F$]`8c$/!^ R8tH#]`t1H#]#q0xRt1H#]`t1Hc${ 8t%˂¡Kl+˅rmC;}{ + .0Fc .0eƺC}7go>_~ȡ+ʡKr.}'>ȫ(^0zW=˫U^4YD/zW=N^z`W=0ƫUƚ4YD /z`W=0ƫz`W=0ƫUƚ4YO ^z`W=0ƫU*Wxyc1^Xt-{|[n9oysVv=>-+̼2˼ ,Ӯ+̺2bW߉<"QXUpy>9@D@D!! D }VqXj!'r!7~!! D },KM=Cn= < z*@1ntyBg q(tơBg:C3>q(tơBg q(tơ8:PsBg q(tơBg q(tơ3>8:PC38:PC38TuqtơBg q(tơBg q(tơTg|ǃ:;twޯ,#Ȼ*jg߬}jެ˫(+_Ve>j}Y /(/(+(+~@Yy++(+(/^(+(+/!° ;_6B PeF(6B P0la8b5PW9e5pqVa5p;Y jnVx8e5puVj&[l@-^%.3Va5ՀOVX f5/?GX 8 %6B P0la# `F %d5PEj/ꑔ{Q̋z$]#)I9HʸGRE=KΉCВZCK~h?-%P?ꇖKВ;PB?Te~!|!!{x~?g|wRU=U4TJUϣ U=SDL#3?]Wg ξ8E)NQ|[>9E)ONQ|rS'(>9E)8E)/NQ|qS_(8E)o79o}s@z_ߟK](-ei - - - - -NxC7xC7xC7xC7xC78 - - - - -D7xC7xC7xC7xC7xC-D| --P@K(% h *ZZB-P@K(% h ZBZ ZB-P@K(% h ZB-ZB-2Kvg@TC&QźTeʘ"ePCy%T{ʕGW=ѕ'Eϧ<)z$IQ]Bt*T` WB<) <) <) <) <) <) ,*J%EWVVVVVd^*J$X+K+O^<) <) <) <) ,ɲX{jOK /&X`jK /&XdjKIZK /&X`jK /&X`jKI%ԑd u$XPGE u$XPGE u$XPG])CBI%ԑdQBI&HKKKKKKK=b l"++z?Q~GT?|1QGfy=N<С0)t(LCa  ShSPB:TMC`  SPB:С0b  SPB:TMC`  PXp‚36 g(,8Ca! g(,8Caib PXp‚3 U Xp‚36 PXp‚3 g(,8CՂ3Xp‚3 g(,8Ca"nci3 g(,8Ca PXp‚3T-8m,8Ca PXp‚3 g(,8Caisւ3 g(,8Ca PXp‚36~^p^:ׂ32ZfClh -e6̆Ĭ2ZfClh -e6̆22ZfClh -e6̆2Z&2ZfClh -e6̆2ZfC$ZfClh -e6̆2ZfClhDlh -e6̆2ZfClh -h -e5вZVCjhY -e-e5вZVCjhY -e5,e5вZVCjhY -e5]g!`p(؅C. vP ]8¶6¡`Uv ]8¡`p(؅C.l]8¡`Uv ]8¡`p(؅m؅C. vP *p؅C. vP ]օ]8¡`p(؅C]8¡`p(؅m¡`p(؅C. vPep(؅C.lap(؅C. vP ]8TمCa ~`p(؅C. vP ]8¡.vavP0مVhQ`VhQ`VhѻZXEbpkٟuk'G:ߓ|O=d:ߓ|O=d:ߋ|/b:ߋ|/b:ߋ|/f:ߛ|of:ߛ|of:/~t_"|Le:/~a:߇|}a:|}rvñdb W|a?8s:so|u/Z{O w_w~8?{ Z>CkZ>Ck[>[>Co[>}߇}}߇}߇}߇̇`>|;߁|w0̇`>|';|Nw2̇d>|'w}w}w}w}w}w}7w}7w}7w}?oIωYuA. Q&&5^i͟6oiߣXgz:ٟ^ubAbAjAjA? GF|Oٟ~XqSٟK~19e_FuOٟ63b)˗/_FL|1eĺ̈uOٟU3bˈɗ/#&_OEݟDFAϜz|3烞9g'=s>IϜOz|3瓞9qO|[LF@yMFo7n4zivMMFo7n4zivMFMFo7n4zivMFo7ΛFo7n4zivMFo7n7n4zivMFo7n4:o4zivMFo7n4zit4zit4VpoC1nC1nC1nCU `nC1nC1nC1nC1nCU:>5jj֊#9?$?{BC,C^,C!K^,C,CN,Cz^ϗ, GV(8B GV(8BY8B Ppd#+YQ Ppd#+T9B Ppd#+YQ9‘ Ppd#+YʑPpd#+YQ‘ Ppd#+Y Upd#+YQ3Ñ Ppd#+Y GVrd#+YQÑ Ppd#+Y GV(8B#+Y>AG:|Б僎,td#Y UU GV(8B Ppd#+Y GVtJ GV(8B Ppd#+Y GVi0?#6` QCбB _ϱ1~?t+?9*D$=BH # *D$=B(J z@X D$=BH # *D$=B(JL z@XT%@{IP!z$AGTIP!zA%= p^%A*D$=BH # *D"GT@XTIP!z$AGTIP!z$AQxQU`PGTIP!zYƑ@L 3 *D"gtH=BL 3 *D$=BL 3 *D"gT@XTIP!z&AgTIP!z&AY0 z@㿱H!0 _(Ba P/>9 _({r P/0 OBa P5 _(Ba P'0 _(B/0 _(BaP/0 U'0OBa?'>9 O|rj0sP?HlV6[mojjV6[moj5 Ng0ʷ,/LҬ'R?=OOz"5ٟHH&zjXYXY|WYXYXYXYXYXYXEoPfVfVfV.*K+K+K+K+KK%ѬҬҬҬ#4+4+4+4+$"/*K+KK($J($J($EE.uQs#?d߲? l䗱_F~el䗱_F~el䗱_F~9l䗳_F~9l䗳_F~9=F~4{߃l`#=F~O6{ߓhd#'=F~O6{ߋ^lb#*b#F~/6{ߛlf#7f#7F~lF~lF~lF~He#_6e#}F~6߇>lA:߇>lwbEXѬ}'V4k\?@]c/0C0}C0C0Caa(oa(a(ڄBI\BPp0C0C0C0Ta(;p~ 燡p~ 燡p~ 燡p~ 燡08? P8? P8? P8? P8? U.a(a(a(B#.4½ʻ?C2?ǷI'7PZ(} UPӪV-JUoRTM*UIQ6J/R[ %V ' ꭅK*UIQ7)T&E(IJ J JZ()Z()藪9RUKUə/UFI2UBIBIBIBIR %dRUKUI/U%ZTU% c^3$˗,_J|6JTuj4RթҒZHUJԋTu,_OEI~=Q Q %V %V %V %V %V %dQz,{?Cz-_Om$S %V %V %V %V %dQz\%YTDדhDz,_OEI~=Iկ'ɢ[hѭ)(lZt+r2V3x~0?k‰O <"ZNCih9 -4rZrZNCih9 -4rZNC!ZNCih9 -4rZNCih9Dih9 -4rZNCih9 -h9 -4rZNCih9 --6܆rZnCmh -6\6܆[%UfSʳ'>vvJi7vkZ%=Z(BIJz"P#I풡Ji7vJi7vkjjjjjRM*dRM*')Z()Z()Z()Z()Z()v+Ji7v+JiIzZ()Z()Z()Z()Z()^$v+Ji7v+JiI Jk[ %V %V %`ѯ%W\RZrKiOR`ɕ/%W`RZKi /%X`&W\RZrEMZU7j&XT-`Q|,3&WT-䊪\Q|+orEu_?Xkߵ؃=Ý=Ý=Ý=Ý=Nv6 mp'o;yNw6ɝMmr'o;yN&w6ɝ-mq'o;y[Nw򶸓-[pla&~oG3kUc|p"h՚ɗf՛ɗf՜ɗf՝ɗf՞ɗf՟ɗfՠ=zPoM"^ E1ܡܡw(vCP`b;;ܡw(vC]Prb;ܡ.w(vCw(fܡqbw(fܡqbw(fܡsb9w(ܡsb9w(ܡcb?ܡ?ܡ?ܡ?ܡ?ܡP|p;ܡw(>C$J-O¨$J-O0*<R˓0*< R˓0*< R˓0*< ssZQI&J-O$J-O¨$J-Oh0ZR` & wOh0ٻ|ba0陇5LLzf^ &=yWIϴg`3j0s5|_z_罡ZZZZhohohohohohqZZZZZʼnohohohohoh'Zh[./;" H/$# H1`dA&)# H3$H# H5$h# ܄oIGȑs$ys9 mp*aI8\N>9]8y((It^Iy%aĝWxR2y^yW}^Yuv2Rf_Ѧ3MJs;9Ϲ>x}sewx:m);݄;ބO|j,jyjjjjjӫ:;;;}n~i~m~a۱_m);5ڴ_9۵_ڶ_۷_yڸ_y۹_imݯWFwUN?AM??@עX}ſ{f{h{j;Ŀ; ; ; ;g;doPg!l(9KkEㄼX7cl|FX0 }ٱF_9ƾs>رF:ƾvD}5X0 }uرF>ƾ~D}}mcD}5X0 } uٱF 5dpQcbkX.8(vF 5]w2vQcbkX.8(vF 5]pQcbΎ5 ]pQcbkX؅sqb:QB9]8e.tЅsqb:QB9]8G'Pc (v.tĒ ]8G (v.G.G.G.G.G.&Co{~H?{d!d(Ld(Ld(Ld(Ld(Ld(Ld(N b9 x5aW9LYf dE/a@YfPcPc ?2̢0^ ,zk0^ ,z 2̞ƞƢq dE/a@Yf dE/a@YfPcPcN0{^ ,z 2̢0^ ,z 2̢0^ߗa@Yf dE/a@YfG,vc?agLgoA|>=hbI#W+7߼+7_____z#Go=[z#k!k!k)ߚx:wPΝ+RWx:UBg _W jث;c:s:XBg _W *|3^/tƫx5nnWPcOPcPc+Pc+Pc+Pc 5+Pcx2@UqW}*?[l~\y:WIK|燀چ2ÝŲɝ²ŝ²͝²Ý²˝2Nas,SXp\|r|q|sprܸSX),V<))f4NaNaNaNaq¹SX)Na?;Lv3jsÝ~.w 3 ҹS~kܝFFFFhÝ.DSht ب٨FFFFh˝.DSht ٨٨٨AFFFh(Na)Dht Na)b4:]Fv1nFC9w Na)b4:]Fv13&j,FSht  ):yS*t z?yMTw1U=L}/Se_cL}alLmm1Uv1Seel36gl }0UOTپ*Pݘ*۝=*;ʎT1***q*}Ą2JP%rrT9dg1Uγ*9L\#&3UL3rd*glreaLGL`0UL3'ST9s3Ua>a>a>aƦjl|}?י*)nT9}D}D}D}D}DM/B/qxf3Chٟ#3sdfϑ92?Gf\ٟ+3syfϕ2?Wf\11111qqqqqٟ ٟ ٟ ٟ ٟ Gf}dfGf}dfGf2Cfw!3;dfg3 p[a(l}>6XPX_0F7(U`l}[2׌=#l4'C=(dzR(Ib&+үKb.9+үKb.+үKb!+үXHb+үXHb!+H+H+H+H+H+>_!W|HCү~Ň+>_!OW|JSү~ŧ+>_OW|JK_ү~ŗ+_%/W|I_ү~ŷ+_-oW|K[ү~7+~_#WHG?ү~ŏ+~_#_WJWү~ů+~_+_WJXqm?^q㶛&m79n_rŗ+\/W|_rŗ+\/W|_rŗ+\劯P|+_ WBP|+_ W(B|+_ W(BP|+_! W(BP|+_ W(BP|+_ W(BP|+_ W(BP|+_ WA  0E"L@ƠP (a0E"\@.P (pE"\@E((BA PPBFe!w!yx8>V+IůNJ~uR򫓒_W'%:o~^79NΛ٦WMKƔy\zuL,:o^7I'W ҫFyCp~u8:o^7CW獼ЫMyc zuh:o^ԫnS;SnSRnRRnRrRnQR/Rn Q.QnQ.MQ+Q QnPPjP.IP'ͼ{cyY8XzwK=;xRNzg_cS'yO;hqPzozөzqzMz)zozzoؒ%^Q^P^zP6PzOc=~ݽ!u|w^Ϋyu;?yut^}<@={\ ΫHcW7`WGE/t\5v^5v^?:;;;;^/x:j:j:jt^5v^5v^5v^5 ^quyuyuyuyu|ΫΫΫΫƢt\5v^5v^5v^5v^5v^?ꨱꨱEs/{(xG ?^Q腚?, ]_eG7:)+L<>`im)Fߏ⿠Gt~OP..LL|r0Qc0Qc0QcߏƾE}?~5 *e&j&jQGQcߏk(첳 rξ=]vA:ѷY.;;J;J;J;Jz.;~5(jQY.;;J;J;J;Jz5]v(jQY.;;J;J{ѹ~Gc:?rvʵ^OI=x=%Լ.1RCκYWupUuU7g]U= gpY gy;:j=ଳZ8:j=s<ଳ:8c}_{YgpYuVgzYgpYquV9kֹs"笅Y ȟ?g- Z@TBe#P>Be#PB;we!C({PB;w eɔS({PNB;w e%K({P.]Bٻw e%[({PnBٻw3e-[({C=rHG!9$#{8_?]Ç{x_m~_ 5€ oC 8ˁo/w!vW~wSp~{Co)8Pv .o@7'SN`Om`O`O`AҞ^X/m,^Yo,YDqzg[w^ZX,₼X,Hvzgzg5dz^ZZX,YD}q;c{g5"jEXC;cYD{g5E;wQc!"vzg5"jE;w{g5"jEXC;cuYD{g5"jE;A{g5X/-B3;wQc,YDX9>+G;chgs;chg팕գrz3VFvX<+G;cehg&)9n&)9n&7Iq7Iq7Iq7Iq7IqIJIJd_Ss /zp4K<_PJ^_I+)y}%%WR|d}%%WRJJ^_I+)]Q+'yD1(żrWNʉb^9Q+'yD1OD1MND1MND1MND1MND1]ND1]ND1]ND1]ND1]ND1CN-x}آ ]e+8kƾӾ.9-zw *JWVQ=(g_Y={k\='x5x5x5+( _YEi*JWV}ex5x5x_==X4|e+( _Y={UPcPcPcPcouWV2+`_YE2*vWVjjjj}e+_Y.tͬrruh%W]QwӪK*^uIɫ.)8=Xc]Ǻ.uCq,X6ٱlc(j8VߏƾEϱџc?'L-GQcߏ~_X}?џc?*HUOPGGQcߏƾE}?~rcbkX}„XGc}k}?~߹.8.vv eXGQcߏƾE}?~5p.sw ]9wO6LGQcߏƾE}?]8bι؅s.v᜻[QԸi,7&ro[n"Ƚ&rokofa >|؇|X?㟿:>rGA`_9+} rW69l69l69l69l6'59lv9lv9lv9lv9lvyuB; C; C; C; C; p~#A}Gc5pS$pST3>~O_pST>}ݗ$ 5V9t`CW9t5aC%Ջ|]՚|]՚K3:ϡ3:ϡ3:ϡ3Zϡ5Zϡ5Vg9tu&CWg9t@C]vWyw.ʫjJΫjJΫjJΫjJΫ꼓)))9)9)9)9:j!N&;ZkS#N82q+)#N9)))9)9)9:jJΫjJΫj*ΫjJΫjJΫ{9)9)98)9USr^5%USr^5%USr^5%USq^5%USr^u^jJΫjJΫjJΫjJʫjU[V!nGXa5V[nGXaV;wV#YGX@V~!O;~쿛_[y{7է{āOo=x$MϤ4<؃{\cCWbSV _}G2(wLƦdlLƦdlLƦdlLƖdlLƖdlLƖdlLƖdlLƖdlLƶdlL6dlLƶdlLƶdlLƶdLƎdLƎdLƎdLƎdLƎdLƮdLƮdL.dLƮdLƮdd&c&33ɘLLf2f21㙌dd&c&3sɘL\f221de&c3sɘLBf22d,d&c!3 XLƂg223 f\/^0p`z\/Kpὗ^z;^zY;j,_T5^)?ĵkRͯ[p 0؛`7€co){c ?0|zq 1ӋcI^1ſG/ߣ95C}f|zq =CS{5R)jlAMƧ7Pca 2>8|zq )ET{56Ǡc0|zq 3>8|z^*ETcP1X>8|zq 1{5R)jR:Oo1ӋcǀOR1Ӌc7Ǡ.c0|zq 13cgǀ(Q>9eh `|Fq 13cgǀ(Q>9h:Qf|F9=gQ|F;gLɳhbP|+_ W(BP|+_ W(BP|+_ W(BP|+_ W(B lq\yc=a\}uL_W1}uL_W1}uL_Wq}u\_Wq}u\_W }uB^W' }uB_W' }u_)}S#N闝M]C2q1)cS#NW22\28޾5p}k<o_xx8޾C518޾x)9ޞ)9ޞ)9ޞ)ْx{Jx{Jx{Cg䔗)))k,(vj,vj,vj,vjKX X X X ԸS?ߍNwʩN9);rZS˝rjSN-wkSN=xěz75yI`uKև4\`Of W)=>֧MpbJᤃ03 .t~sb}:>c᱃_x/< pb}:>c~vlA+rr2:됛3әA+Ogا3T~eЯ"QC2xܯ>cOgا3x^~eЯ"QC2xܯ>cOgا3x<Я"QC2pWF[3+p?}Q2h/ ~}weJJ^^I+)yy%%/9dy%%/啔2,啔WRJJ^^I+)yy%%/9yy%/啔WRJJ^^I+)yy%%/YgC j0g3 a fRq8 b, ΂p8bPq8a f<6W, ΂p8bPq8a f<6΂p8 b, Άff<60x, ^- M[2p60xlc1 81pĀYgA 8vwR]lc3 a :*9p8 ;p8{o8{pI`;SK`;us :%Sr :%1@tJD@t*D@tJD@tJD@tJDg@tJD@tJ D@tJD@tJD@tJDg@tJD@tJD@t*D@tJD@tJDg@tJD@tJD@tJ D@tJD@tJDg@tJD@tJD@tJD@t*D@\ !Dϵ8=@tJDϵ8=@tJDϵ(=@tJDϵ9=@tJDϵ9=@tJDϵ9=@tJ Dϵ9=@tJDu8=@tJDu8=@tJDu8p :%Sr :%Sr :%Sr :%Sr :%=>ȟr^/R|-R|-R|-R|-R|-R|-R|-R|-R|mV|m|mV|mV|mV|mV|mV|mV|mV|mV|mV|mV|m|mV|mV|mV|mV|mV|mV|mV|mV|mV|mV|m|mV|mV|mV|mV|mV|mV|mV|mV|mV|mV|m|mV|m׾+U3WTYKcCT=C|z*O\xg8w`xgWxgfxg_xg_x/ 0Uv߁c߁LCx!<6/x;|۴uv 8 <vbΓȤ<:>Nϣ<:>۽M.v=nkۍwaW_].Ov: ո6?׺^[{va7Gj7^~ySzz{{{{{ = j7ln>|OG>Y'k|v'<:&3u&ΒO:G>Y'|{s؛)؛)Cz؛)؛)ػcoJ>coJ>coJyt)؛)ػcoJ>coJ>coJ>:؛)ػ e[AMzY˜˜:鷎_u~,ʂ4~+xo:7+xw:ZD["xZ`)c)#%_x |ᑒ/xbYB<]g },x:>x..ɳ؅>xbYB<]g5cuPw,>B_ԃ''S/NޜMk)y}-%5RZJZ_Kk)y}-%5/RZ=&LSRx))<?SRx))<{J 0xlcI1{J =%ǞcOIR=%ǞcOI 1x1)T0=V1 X0c@U =V1 X0c@ sHgz~zb豊a*zb豊aE鱚aǂzb豊a*zb豊a*c5 ~q0=V1 X0c@U =V1 SU eaǂث&ER.Jy(:Rt(St(ePt(_PJkAה3"]tK1ݏ}>T?c%.tǤK>&]%!]%!]%]%!]%!]%)]%)]%)]%)]%)]Y%%]Y%%]Y%%]Y%]Y%%]%-]%@-*BE.+pOL~ ~)&ޙ>`&ޙ[ӗ|xooN_K>=}„2y }|ySLxK>xK>xK>xK>xK>x&ԐLxG¾ǾǾǾǾ>aBMy }>`c0ߗruN_y}w!{ۗ|׹}{ܾǾǾǾG2s }>`c0ؗ|ؗ|E}}}&< }>`c_c_c_%<% }}}}E.ZbPܞcGQx(<0j.Zޟt?WsnOD|j0n /_7h|SPD=Ǧ/xl|c _<*H~/xl|c _cG/xl|/H/xl|cϣʘHQL$o|MDʗ䍯 L$o|cH{> M/xl|c _zQ0/x)d"yG/xl|c _m|c {@ H{<6/xl|c 6_{P}M/x\9߯gT_rqzHd)#]ͦ mFڃ) c؃7Ya {7zgaH܏H܏HܯJܯrܯJܯJܯJ]6w9l.asw K]6=$l!as {pC6㑰y<6GH< #ax8l㑰y<6y$l&a0 Ic౏bX綨ڎs[ #"Uı8s?<ûSqdw*gϫ9hs4рhLf-z=ui{vZ`%\.["%B.["%B.["%/["%B.["%/[>.˖|ْ/[ReKJlII-%%_˖_˖|ْ/[ReKJlIɗ-)%_˖ lIɗ-)%%GRr$)%GRr$)%GRR$)G39#I)9#I)9ɑIJɑIJI,$HRJ$HRJ$HRJ$HRJ$H~6ERq$)%GRr$)%GRr$)%GRr$)%GRr$i?#I);GRr$)%GRr6%'jSr6%'jSrv?)9QnSq6%'jSr6%'jSr6%'jSrv?ΉڔMɉڔLxn"+t @J @JWJ~_)_)_)_)_) __)_)_)_2ŗ)Le/S|_2ŗ)Le/S|_2)Le/S|_2ŗ)Le/S|_2ŗ)Le/S|_2ŗ)Le/S|_2ŗ Le/S|_2ŗ)Le/|_2ŗ)Le/S|_&2ŗ)Le/S|_2ŗ);懨ݨۦ-?uxigy 7mnwt{q=7iao:p؛ao:~ {s8u| }  xaØX؂8øpaphgC;)9B;8C;)9C;)9C;)9qh'%vRrh'%vRqh'%vRrh'%vRrh'%vIɡIɡIšIɡIɡ=&vRrh'%vRrh'%vRRh'vRrh'%vRrhgšIɡIɡIITIɡcsh'%vRrh'%vRrh'%vRrh'%vRqh'%vsh'%vRrh'%vRrh'f=p8 8ba!8ta+++++++\90eNSq4%gNSr4k>#k>iiiiiiiiii9_s`|!C5k9_s|)S5'kNל9_s |)K5k.\_s |%K5kn܂_sME(S}^_U`?S`J^2)y}0%>S`+8R#횔;).)owKyG۽RޮKy)onR|Hy)͗7RHy+]ʛxIy!-XRbKy#-p)o{=>S`J^L)y}0%>2^L)i}0>S`J^L{ ^L)y}0%5x}0%>S^SwS)x\W'؉Ex"GׇbmO.sEE|{'1ZZFEcZ[FEgZěFEk.oOrثI~2KEإ"Rhvgjoypj^=VOS~VOS7n [=v{ܙng{솿nC{솿ePIzV?ge7;| {VŶ+bHzXugeس2xY-HcbHm .A]&YA| {VY<@]lw $6| ʙgeس2xY< {VW.bHm aT0wgeس2xY< m .bH{XzV=+Ǟcgeس2x *$UA2(cceس2xY]+::::::::::#:+a}>|}T_E['k|Qz(kkkZVStM; C; C; C; ; C; S; S; S; S; SO'hIx4wIx4wIx4wIx7wKx4wKx4wKx4wKx4wKx4px4Hx4Hx4Hx4Hx4Jx/7Jx4Jx4Jx4Jx4ץ. unKx]^4ץ. ioHxCސ47! ioH4H4H7H4H4H& 4nI& p\K7nݤtŗ+\/W|_rŗ \/W|_rŗ+\/|_rŗ+\/W|_.rŗ+\/W|_rŗ+\/W|_rŗ+\/W|_rŗ+\/W|_r+\/W|_rŗ+\/W|_rŗ+BP|+_ W(BP|+_ Wk]|+_at@ MĐm Ɛm Ɛm Ɛm ƐmLƔmLƔmLƔmLƔmLƔm,m,ƒm,ƒm,ƒm,ƒmlƖmlĖmlƖmlƖmlƖmƑmqOƑmƑmƑm\ƕm\ƕm\Bŕm\ƕm\ƕmh%F.1p -pHlHlDHlDHlDHlD.B@"d $@yI[ )y $%o-ƈx $%ox $%o-@RHJI[ )?7{"3hneZeZeZe9 :8 wp.550\IM) eg2BW`P_[(0U(\(7omCMy )p2) x, x,&<&<&<p )p{BلBلBلB^PPPPPޗ y e  e  e  e  e+mmCMy )p2)mrlclclclcCMy )p2)x,x,BفBفBفBp )p{Pc?+Znp{n/:X eʀ[+V(nPZ Bpk2`Z{֪V*UmnJ;pkUف[ZuF|['%n֚XPֈ_/S|_2ŗ)Le/S|_2ŗ)Le/S|_2ŗ)Le/S|_2ŗ Le/S|_2ŗ)Le/|_2ŗ)Le/S|_&2ŗ)Le/S|_2ŗ)Le/S|k(k(k(k(k(k(k(k(k(kk(k(kĜ9w39`W3i ӆ$B]f9"<sDxlzc _<6P=GǞ#cM/xl|c _< *9sDx9"<6R/xl|c _$#csDxlzc}/xl|c {e̜sDx9"<^3_$B f9"<{M/xl|c _w6Ҙ9P3{h3{8!/3g66d0sf _$B-f9"<_z}@]B9SeT_9"k=F;SD=D;ۼ;0;;{I?շ```7Ok0xk0xlzc _Nr@Se5<5<52 ^<6౓P2   }TM/xl|c _IT} } } } } r0Uf _Nr@-k0xk0xk0xk0xk0xlz5/x$fL?\ΝvDywZ|2].Qf%Ō!0XR cK-#0p @J @J @J @J YHHHH8kp %gRR gRr %gRr %gRr %gΚHHITHHHgRr %gRr %eRq %gRr %gRrHHHH8_9W 2|3']&)RuIiiH|C,3! @:3!kI~gYgB T~ю?)^e ϙ7q7xd wGy7xd wK/ S/Nf{06 [߃qm|jkoQB^ {0q0K1 k#ȸ6<2 ^J^B^߃imxd\ƕ׆GƵqmxd\/ίZDžBLk#ȸ6<21 k#xu~v=.PDž`Z׆GƵqmxd\e\׆K/| {\x~ /6<2 k#ȸ6<2}l!b\xC2.!^ qmxd\"676=Ǭ12\)å2\)å2\)å2\)å2\)k;e,i%픱2SƒvXNK)cI;e,i%픱k;eli-픱2SƖvN[)cK;elȉS槶SG)#vH;e~2?NȉSfvlNSfvlNM)I;e6i&٤2SfvNSfvN])K;evi.H;e>NS#v|2/yM /x$G %NjY4/yM /x$G / (^@м&<_H|#<5_UV_ɫIBAy$07ݵBiT}9 /Q5*F /Pe*Bޗ^υ*B^9 /P*Bޗ^ z_z^B_x }u*ש^B_x }u*שЗ^B_z }+]x }u*ש^B_x }u*ש^??^??^?:dg -:(:,: r r ^/&<^z}K9J9KB\BܥBq^Jn!EzPu%Bր[p Yn[p Yn!k-d Gn!K-T 5 5Bր[p Yn!K-T 7H-d % dCǬlx]c>@N\(Ȉgo[~zB[hh XϬ|ևV>sQvx<˴>{ٱ얞-vٳ엞Mˆٵ옞m˖ٷiP]垟],?ˬپL%=-n ]]^RvW>u\ۧzqUo:SU}긪OW>u\[ZW긪VU2qUozku\[ZW븪^U:qUoze\[zW븪^U=u\SUCqՐu\5dW YUCqPu\5dW YUu\5dW YUCqՐu\5dW YUCqPu\5dW6j:!j:!˸j:mqՐu\5dW YUCqՐu\5dW YUCqՐe\՛qՐu\5dW YUCqՐu\5dW YUCqՐu\*㪡j:!j:g!Wl4.z}:mHߛ?-BմEȚY!k")+++++++ ++++++++++ +_|lBzas/?ſr;G<_#~o,%)].␵UCVqWʠCN)*jVwilRU2(CʠCAiܵ J8d2(␏AiRUҥ J8uo}jYkXO-|z0Npf(;8 ;STf;5N5S(o;kκ"5;-YMe2=i Zf,{<ԝe2+gY,i?, endstream endobj 17314 0 obj <>stream hn_/?n0ub@r yeheyq&'.!Su&eKi]s%5ڴ-Nke VSSS#M1&=[:TV5ڔLkSNM=4V5q]k,S MC:lܦJ&ôL͆.깪*G%u,a[Rji&.VO_R3ӒAV X*0w,%iti׬1Z\l1Z[mצ0Yv}׼ʉK_}Fj]|vy )̶[*vZPmWjvCN! Ejif\ ?7H iEZz y$(RBYm).+UbU-`Q e=גlSNVwn-NZsb|-AخQ#Z좓htf.Eq$Rc3i5]ץ|Yj;=ʳEEix*>%(?J^oꥱjvW;Ҿx$nF\ry 1zn.b%)#Ud%;S٣}A`Hw"o?z͛޸[uz#}?߾{_B~C Z*+2lYGYYki>XY~z[/>FGQyx\&75EڎX>lW'^o;~^|F?ԃ8q zرDi{Gk)x{^*-$ES1zI~95n ++ Pd}blMW;`=cqN'}H8]61<뎻LF!1#R\Shxv=ecZO$!q~,"~?E)_jy ?c#{1uf?~lվ 'squ;o[Tt{GgGK4\>+dQ>~lHbs4{{}b~ $h/  eet I:J-~كß>r`=GlÜoowFFs?d~s:O=̮Q3ߨ?q^?)}06>Q;{hwAzmˆ}$){|%~+ ~=vZ}x}w4q?%g;X^q~>#µϷ j}1%I<}?ِB ѧ!ɿ> ?><L_^D7>ڵH._v~/l j@ y/<I÷ =-q ā8~fqaFԈQ#jDTR@5R8)|E쪨c1vU5R8)qB] (5R8)|@쪨c1vU]]`WEB5FԈQ#/T*P@@q v*P@_Q#IU‰)N 'U TGAQǨc T*UFHp8`&M[nȖIU‰Q#jDlq qǧQǨc T*Pr#AQ@U T*P@U T*PŇLAQǨc T*P@U T*P@U T*P@էCjDN 'T*P@UqPǨc1U T*P@U T*P@U T*PQ#IU T*P@U T*P@U TU_<^߽^Ks|I6:cF?.}#\mbW K'ǞvH԰!m>f\b9 s=]Wޝnxa=/fng^0}e>b yΣ#mY몰;AiǾEn(~8线lI[HǬpl|WB^ y%U T*P@U T*P8u:FU T*P@U T*P@UgEjDN 'T*P@U T*P@U T*P@A1u:@U T*P@U T*PkP#jj|۽(bs<eX?뜞d>sh2x:{ j8ʈG\7C35vݗm\ϡnn_K>Yާ^s}R;Bע8jDN 'U T*P~%T endstream endobj 17315 0 obj <>stream h͎,G[;,/{ebX#< X3c!/" $B̪|de1RNEghRNeÓj;:sj{,׎؞Fo;8+bm2}*+bwZX}OUcWM%>nњ/$I'u-c]a;xm}o:j[j׼W:5nmnuk>oV[(jLirw =+Ց#gk"G9]:ꂊ5Օ5uXn3k60vxʣDJȯV"YkWUdeȯl'3>#Y)ʔ|_jȯ4j%*"vs߿,iF~AUߥ;}ȯv0ȯBu]U#Zծ-J4JӽL"R/򫝮9"Jq_yuFWwo;ȯ#JYw_8)W""JWj:_]<]gnye-k^mcͫ/5=5)'5Y-g:z~l';i߭՞Z<[^:=[^)Rx{~-]-+ww.y먣WzV9xݶ7G {MGom1{Q}cM.=ӻJ#]m.kO1wc+Xs1&(OqhHe&|\=-"a`14f]{#vNXdv$?f -^Zm$o .b>/_=x?~ww_<~߄Sw_><ϩ1קgy=WD]w?~{;ﮫ\^FF**********⿹P1دQT#OU4N'TATATATATATATATATATAji4N'TATATATATATATATAT3/>FǠ FIqBTATATATAAqc*jFy1 H58i4N********QEqP1} PT#I*********~XCqP1} PT#I*********~XCqc1TATATATATATATATATATATA?F' UPUPUPUPUPUPUPUPU⠏c1**********⠏H5TEqBTATATATATATATATATATyF' UPUPUPUPUPUPUPUPUPϼ(}>F***********5T#I**ROHxd endstream endobj 17316 0 obj <>stream hۊ__:I $[!!4HcB>U#!>V{Umyz?ґuͣy伻ȫmQvHGM͵#U<,GexX6WhkZKC;gh1g>Vյkg>vIx\jM+S\zk2OzknֹC?[1mmŘ[^+hxc5{\KyW^3ZtGz9],9;VW++VetXy9\odk'z#JGE=(:a2=۾Rf/ֈ{Ykc3u=6i/65 ,bv`8LҥHjR=?ZG%GR{GQ"{uHj뎤:P@| ٫C^$d𙭞~ZYjք:?<ݽx/߿͛W]pJz~˷G{~}ۇߊq%{y*ʼǿ=oٵ)hvMk>s;9N}]]Ʊy>G`"󨝳wW[ۄD쁋}_'q9*_vc՞qq~ČX!Ž5E\x~nMT7fsSov4Cnpދv;T,ŷvͽ|YJ|vmARg9Nxws*P@U T_Usc1P@U T*P@U T*P@U U78i4NP@UU}g,U-9GYO;v!=LjuN1m,Yvk϶ٗ>-_\rIya}>FU T*P@U T*P@UO78i4NP@U T*P@U T*P@U`}>FU T*P@U T*P@U T*P nč7kq T*P@U T*P@U T*P@Uƍ4N'T*P@U T*P@U T,0栏c T*P@U T*P@U T*P@?Iq*P@U T*P@U T*~X90}>FU T*P@U T*P@U T*Pa nč4N'T*P@U T*P@U TAc T*P@U T*P@U T*P@?Iq*P@U T*P@U T*~X9c1} T*P@U T*P@U T*P0栏nč7kq T*P@U T*P@U Tј>FF[ @Bg}zë[SIbTr}X+d`97*N΅&5'nkoN#ƿ9˲c:6v~?29 t,5@ae,;L T*P@]7F' @U T*P@U T*P@1qNA5 endstream endobj 17317 0 obj <>stream hn$W7`//Zن!X",.4H '"83ݑY_@uySL?Z3pÓj;:sy,^Ζh5bGgELs+"vkÓvN.J:cz쪩Z+55uKǻFNG,OR=UnVyuZVyu-sw<"~xxͫ%DD]G][Q)*ĕV냹ũ1BCcX+ƨ)=xn\&>=VGDfX1V0ۈ1sѣc`cl{c+8kfmMt| c/X02c@-LPV/<4sb`H]6DMjmH|-W[-o ~QWzr?>~7pO>~©w_=<=O٘?S]n!x8>}{9;6Y$[S@3[=|*›cgs]=ΎlϓcN_׌x{}~\6з_ qMm7nH~}v3Q֯yrD^=)=,nWE®|Eq{ܒz{^]Ev{~{O^ M!\^|.&n ꯅ^WZzƾZ]m?/퍼4SPUPUPUPUPUPUPUPUPU+TQT#I*********8(}>UPUPUPUPUPUPUPUPUPUPUPkFIqBTATATATATATATATATQ}>F***********5T#Hq8 (>FATATATATATATATATATAT7>FWWT#ȷ*' ?PT#I*********~Eqc1TATATATATATATATATATATA?F' UPUPUPUPUPUPUPUPU⠏c1***********~XC5R4N'TATATATATATATATATA?8c1} PT# UPUPUPUPUPUPUPUPUPk(}>F*******PIqBTATATATATATATATATATGjq8iPUPUPUPUPUPUPUPUPUAǠ _a endstream endobj 17318 0 obj <>stream hj%__ "N ${B./d${ d\]sVWUZMQz?ґ9ћ\G^m{snt\;Q^,G›hkWo~BF qW׸=g赴kK;E(:qVhY|>znyQy%RuJ֤qgP[֤qX׸kܽٚKQsUi=KQKuwkVt SeoG5ߚ5)w&f;U\_4Zo-w8%WsT{U3o]VkRf4/ >ZoI֚Y֪qGdq̡׸ZָskG5)w}d+ܮo%Ӯ^V Jv-Vs F)Eݐ2ޮjW;k T5j_vͱJ+Z5_J[*JߪiaC^x*S4b&׬f+vmY׋WWZ8˩9z; wW\;կskHo )J34WZ%kĥvWDZ╊NP_5=z5ok%ieJ50zhb旷w_>>ܼwۇ?|w7~x_籯nz~ۧ#5{~tx\SQ??ݼ{7pN}?Pem) Ԭ\oC+i9lyx^qma@iaV{wq{Qs>ao]ڧ59.ug?v6^DOD{oj {=9bm y~gw2?X~2 ia%f乸סk:B{>-9wӮ;WOc}k*mW\]{&'eeXn f\2~p~v[uT*P@U4R8)NP@U T*P@U T*P":F*P@U T*P@U T*P@UXCI#IU T*P@U T*P@UXC8u:FU T*P@U T*P@U T*Px4F ' @U T*P@U T*PxpPǨc1U T*P@4F ' @U T*P@U T*P@U4F 'T*P@U T*P@U T ᠎QǨc T*P@U T*P@U T*P@/֐FHpR8AU T*P@U T*P@/AQ@U T*P@U T*P@U T*^!Ip*P@U T*P@U T*^!1uFHpSu*HypR8AU T*P@U T*P@U?FHp*P@U T*P@U T*Pk^:FQ@U T*P@U T*P@U T*^!N 'T*P@U T*P@U T*^!1u:@U T*P@U T*P@U Tb ipR8) T*P@U T T7/ʕ~X+C>Iڿdh9ζo< *N΅&v5'=87gfH5|/e1g}zw~xiߋ|up)S4 endstream endobj 17319 0 obj <>stream h]kd`H7"B`2Z /y.fNLuWwOVj=ڎZYa$3{nf#lHcv3K(f f>YG}Jq~9wCpͷci+B6.ϡvYcJ^.H%̛C3a[첊-q{]-q{Kl;p+u;-b#ݿݺ#KS_vSl 0cEܿb͖=Z}5J[ YTe]5IY&Qt_QbIĞQRK?fs)VbmYշf9=Y}ZNSpFu۳ծʳk%^;9(]{dR͎bO]I%+zn[u99GLQݿ~GQ&l4<KѽvR:lV)s-٬lVR~6%?UВMYrT+k'WEZXR_J]Fª&ufKܞw`Qs L*jR:SC)_t&vߏ.idGF]E/"^fW%F%nK{X2sc +ĝcGnQ#4c"%˕jݿسY4rݏQRp!v//MAMx%%y-q%lۻ=w;;M;f\Hن !{1:qfeG3Eag d1.vk/qEc/qe9/T1;Ec/OјKهW핥yKc}%m"3" :m!{kʙ +Yp喭K{E_4Sct+Dfr# +*᢮@X`c9LhM"Knn7*H ̊9=kIc.ML rmPѓ]Asxon~~wՇo׿͇p|뛻u?ǜߘq72Rw{dCYkC_kO<3}9FU T*P@U T*P@U T*Pa jD4N'U T*PkT}ywsӜ/0c u@^ C2Š/ ENF_xXԯ}EM#{hb⌾sQܷ!1cg./Xcɖ(Pj+⮈"P@1>F*P@U T*P@U T*P@UƠF' @U T*P@U T*P@?A1} T*P@P)$+gr>%C7%AKR/RU{zչ4Q8_PZ=Js㬬g]w2:kR_4̓}.U|)58i4NP@U T*P@U T*P@U57oϢ9B~,lF*P@U T*P@U T*Pŷ/ DZ}D=uzC;]Ɲ.ڎ㎏;>@ T*P@U T*P@g>F@U T*P@U T*P@U T_)P#jq8i T*P@g/nޟ5{%ƞCxQSa@&{YX1eĶH SϻidbZ5_t?6?D:flq{>ukx,5EчC2*P@Uj qc1P@U T*P@U?ӇC!3AIU T*P@U T`Ji^ endstream endobj 17320 0 obj <>stream h[J3Uuc`H0x@4&gG=%!|=ϪuY ɽ-oUo-ռ9<͵}={3o{e[3uk{ m`9cyvncЮmݵnպkGr*'v#1fjijm5srO;X]h keh; Mz)Enͪ+B98_QM;8_&*zKqpk9'T|-zb^U*+Kr^%Jy\/+"|oBa/ibxIKy"$茗u:vF{=]/^iKesiyݓ;︮cOR13Ce}a5;{w<'b .v?O⺑3{/m7OQ)čk}܌#fARO9Z&{w1:F*P@U T*P@U T*P@U@TFHpR8AU T*P@U T*P@U T*P@U T*P@FHpR8AU T*P@U T*P@/UsPǨc1P@U T*P@U T*P@UFHpR8AU T"~Ճy>I%LÞl϶l{A9hbK<6dsߜ#+|돸6yl{-O9ccp;עx܃gG=lKZ@x杉w&P@U T*P@U T*~)N 'U T*P@U T*P@U T<7R8)NP@U T*P@U T*P0栎QǨc T*P@U T*P@U T*P@?Ip*P@U T*P@U TkT}WI̴?GfH{+gۗ^8?sLk>yt\vv#aŜc>csN}-<=<Ʋ9k>s.iRT)UjP@U T*P@U T*P@g37R8)NP@U T*P@U T*P0栎QǨc T*P@U T*P@U T*P@?IpETKUaB endstream endobj 17321 0 obj <>stream hoen!Nb0$! CxA&V9r'6M͙j9^]纕ն};-U7p8}Ko[ޣִZy+)N߲2nӷm-۷;Gp߶oTCS;Ad2:t/>Ob_ҞF9e7S$4Tl#N;8w65!aŽ?c(dkJKӿxb3meיҡ5zNX'uhVc˞iJhu;|VqGٺ|miiw5㌥ѥg,>4-BLnٵMŕKw[qBd+nWfB_-]#*%\we6ܮ[V2Mv\7I)v֔mYcg5YVOs\ɖO_q}V\|+n'ŕا*W\Iꢼ2U=̵@n*i;&?7-N=SRWjŒU(n3FGg, _TqZnݩ1DTM{Ukj S5K)ng٦LE=LŭLЧ6l•-bz$aT)ӿlMK5&^|V5īg_rIւqkWMXb/GɽV7s5.?~w}wp/~g}7c_<_ݶ?g~so޾3^c<ۿ=g}{܍zs66˺zm gBP,'e^wveU}vώj|o]|]_}|]9kv;:|ո(o$XM:}vY|z6j[p/7$A̵{ 3wt;m_?{#|P͕8؞VG}BI[I O裬y\מG\C?2imzWԮX..spw~e}Xc^k"@<;xP@U T*P@U68c1؏ʧo_d0bdMO*2OY pY6$]b*7]h;]-y=3+q^\L|gs?n* dt> [P@U T*P@U T*UA»* D@U T*P@@1u T*P@U T*P@U T*P@Ԉ)Οp/*PRP#jdĞ?6*P@U T*P@U T*P@_F ' @U T*P@U T*P@ UqPǨc1P@a_ECeX=deSөsdDEsnu4sY#3|ꏸzzgMk{lx]n^y_h]\6hƼ֘D={&L T*P@U T*^AIp*P@U T*P@UO߾~u%a^z-ɚTd,OoMrA</\&S~V}-5{WK^ό~;*Ϗ8L.]~%s?n* dtP<(?x[~r˾}D"@ D"@ D*5F"e"@ D"@ D"@ ADA j5"@ D"@jD?W5~ִ_q؞!5u)1,+Qkj>v6AbyGVWbVZV٥8`8)KMTՠ0S]|h+p]߈W_>Kboqbo)mR~J8񹡆Q:H?l"1W_9mv9_،>t,s=$؎ԧ&DQCP#j?"@ D"@ D"@5F"e D"@ D"@3/}3UWcAU 5j[$Ԉ%[ endstream endobj 17322 0 obj <>stream hۊ%E~@L*/ m6FXiF̌0{<]be? i=TWdFFXtUl͒|nW8~٧6 kkђ)FTwS3J2H)hZ} Y)|GUO;de~3ُ"zlAG%iO eM{oI`%;=1h1퉡9L{bj8GJ!RN˞4ƬvFEJ*jwIE: [4F[kh=1i֓IwLDi.#%8?՞3JM)QR>_RdԮ۩f%OTY\ҦڣY֙VQ ,m\L(^f,])kf,3%ܥ3vXm(g~Ԟ5Yf~2^ѬSj=g~S֙Qwmsj6=/{N}8DzG(Bհ5.{Ĩ=Q);i#L<=*|2=ΙugGeGgi"8Ω81kWN='EmKsR֌uI>p sXe?Dͯ E$S␖-%RMv('Sw8,˜fA]j`fQ1YڄeNw`:UÊ/Jތ:5]fNufkf2*..7Ԗ;4T SQʳΘe?>ŧ/߽/ջ?o{/_՛^KJZ}⳻oݫw_$%|?˷?oN}2~؇ywz*9g?cf,ٶ\Elwv|}3\l4<|(މ{ nlrW ijX &e9|mm[?>'#<+a8QPrv6ڜl k5_y¼rnrUVc]UmMko{f\˾-_}u¾^Lggl׻귡{k tI%pF\y6T*P~_~{U=TO=!%E{{?CnbUDu9?hwݿi} /]m8xЮ*-+.nŹ, U>+l3 6.ޮ gPX3fb DSA @ D"@ D"@ijר5R)"@ kkP@U T*P@U⠎Q Q?*"@ D"@ eԈ)E@ D"@ D"@ Dg "BO QxUx T*ˬ D"@ DQ#eHYD"@ D"@ϽϽ*L~k&U*EbA @U,YP#$ D"@ DHQ#i&i*VY"@ D"@ D"@EE"e"@ D"@ D"@ jD r Tg "@ D"@' j5"@ D"@ D+O+U&)N 'U  D"@ D&BA j5"@?Q#j,R)"@ Dr@w/7~}blihԟҢ!5 _q{V؞?>~ZW.5WWle畞kpr;=kLvM_&1!ܞ_ ۃ?pf@ޖ>:֏@PNh9?"թQk+3HieW;.[1[O?(]ӍMumqiu%TíͶ%?/WBy,[!kgfkfaϯ=c_05?ɢt>eusz0Qw}w/X1'sޘ=co~~=nL(U2?+?i50 HnU1ߙvUVUn}eZ_f]_N|a/Y%K~| endstream endobj 17323 0 obj <>stream h$_^`_@ 101юa>'*'m#huNuTdfĉ/{| 9onx/[Fu>@} n?Z܆h[tN+a!x-VmѼ2-qn9m}[Io5hð:ƭmnVѲ0֭qv~L.6~y4 { 8Ƨ!dc?=2]^"ғK#ؤ+F8?0ٹuܒ" |F;V56zhslQAt<ńQ+[+jl!BQk[HLHvvN]Kx9JIîy%aIh sti9zkLU$AJ'e#A㉵#b-CLc 3DSg6s<sy( h6ֈH4JvD`;Рk]ےhĈf a5H1pbg԰3tL2ja+ Sʌ2 +; A$tjg԰Ƅh9zdԠ{*3jPOF*_=uQbL ڜ 2zBqFg5撨bruT1k;8h\Gw7Fa+a7F*.m[aQ+[ Үn٧]èg!гkZ-93vU $(X+F*Fi9zq[ud#K4Uax#p"Lxi1;]jy%50 F ![G%\p&d2#W0G':*"Cf4!'¨;IG%'tOv*/vd'WG;֒OˬNN;(A*)g3U9fsLkOϨ*ğ3#93rudܹnfUs< wUbǮɓ^ œߨ1<ꭓf9r;j\( ˻vҖ-%:Jd:K`'q.lN\.Cxi KE[Άcݍ9l1w:ڻbW?v6/_k(ԣyy&;W?~ǻW<{v7훫?<_~yьzشvWo}k?[; wO}+tbA `crZ3Ͷ.yF.cd|w> s f$m},){gǨy>['7 }}xo^sY>_}so_~fxo~o״BҋO)2>,q$w#my,rӏ^⼫1YZl^ 1̗ k&ϹCRiW7SSzz^c3υYlu¹n85ՎQ{%r2(JE!gA-dyf5n&Y>>#s>k7Ilq=.ڬj3Aef]Y|kktrΣ;69.Z/,;nj-y&5lPJ~n9^{=AG^S _$=> ܙ?&'v׳rGAM3tG݋o_ٽdbϧɞϲ\&ϋ3*w<1zHɑ0o.oKܬa?πo-|a>.cA]ϯmDϴrT--ϥ~xf&uumԡjbi{ٸ$T UBP%T UBP%T UBP%T UBP%T UBP%T UBσ*QjTTT*J*J*J*J*CPSS*J*J*J*JU<]ݬl"Ǣlg\zY$sl| NΠ 8 3LkNu35wHXBB?{y_3'}g{p.18;MuYc|V ،(5--- D)A?%J*J*J*JH8>v.D#g.g$2\lu_E5QMW:չP%T UBP%T UBP%T UBP֥FQSSS*J*J*J*J*J ġ>>>&T UBP%T UBP%T UBP%T UBP%T UzFj888*J*J*3Gի7Ow7(H(Yb5^d> [!_Ө3h-¥ $ӚSLͬ]5Џy6^j׌wIٯq>'fl/C NNS݆/ay_"]3ILBP%T UzlFPSS*J*J*J*J*=6#5JjjjB(5qqq UBP%T UBP%T UBP%T UBP%T UzK8DŽ*J*J*J*J*J*JHRP%T UBP%T_P*.x,vXͥ5O1Vx׮`4 ppi?8ɴT7S3k~WE+,c^5|ҷkk : Tk{5l"HLf5P%T UBP%T UBP%T UfQjTTT~*^%Ir*|NiٜJ#+t%+J/PA_CTkttN< ĥ۝'A ĦFu1lN_&%ew`h^9{/uvw)qgwosyo}ޭA[&ZFWE*Į$C}L}L}L*J*J*J*J*J0(5qqq UBP%T UBP%T UBP%T UBP%T U-4 endstream endobj 17324 0 obj <>stream hOodRWIEXADYD, ldEy}==, `Ƿ9Mӑr[{gT>R>#]sr}r1帖z-鸑Fώi鸕*-F;:".k-G1j\U?fw^v8{юeխcqV[hke_=k6EY+2cpf۹8V1;jeʱGW{Xr[K*%XoñM{^c߱#ֻcg*؎]X6s,c9YJkjmyGlk8_Mi^Xw;Sն;vi8cw8k] GPkszI#b{p8oZy(#jѝu6vfSD.^M9oCءR6gv޴Җ󦌵R1S.c, 4V7vkG.tJ"vj{N665ͱm5mjpN]JH?VXfy[%հj؝sVV$WmM V;o"ݤ)X>n[GlؚmuMwqX;VZؙSҰ;o1JQ3cFm*& ;N^,v Wufu:Vy1ubVJX3Λ!"VeYv8ɤ͓cGv ctN)/j![AY̾#oY̡q 5ձmXͶjqf[{9V^+$bpF$\Z!^ .ʒVİ uHKuةj]i"FVɒ5&KVzkΛtt"tpWǮ:o]fe8o:^[$ Kv]Λji)7byӽFpfy%{LM jIuوr,KQќ83m]@qIt'o,[>__ΟieF,67dS8MݤVqw`u:˧;KBw.:5ǻ^?\ Τ͐CfNwtghּzWˎ\@i䓻?O/WO?_ E/sw;קgd|׿|=r΃?>k:o{<|?vOp %kßb#>y:v^??_sqoe^\gr#e|>GYLn~8&j?>xuy/~9 ~uq[:rQ <7\tlrlF!FY?3.yJwk_TFhs!qqۍF************XC58i4N*********XCqc1**H58i4N*****GP4N' NP1} FIqBTATATATATATATATAT>FATATATATATATATATATATATAH58i4N*********XCqc1***********F' UPUPUPUPUPUPUPUPUPk(}>UPUPUPUPUPUPUPUPUPUPUPUPUPU|ji4N'TATATATATATATAT%H endstream endobj 17325 0 obj <>stream hjd_eu>1N 8τ\\(3% yUWk`\6E{NW{wnaqhA?-2-[S–C)-Q-J[eVp]puum%ٳQ6m6,JtQ 3\KZ%Z]iV,MZCiڀBm^6sv)sٵmӵMúV8\?'õM2mrܴ;[TIa^kQ][u5mڮ׎-YQR9ԊEM:={jiZ6fͦqmScvmWغkǦ%fNÓVe -´Uΐش5)l7e!yӮrZyN[lyt)y>k5(ŵMtfySmC>5%# ˛UPz!4(ݵuQT؛kɜ*1v&&ZϛoyӢ`Kƌ7DX%ڤM\0 -/!6mbmfՀ`^, ˴!zͫ]ow5ڲ!֑MoPOfD7D ޝ_|qot/7뻿՟AHۇO_x+o>A?_9|sᗛwVc\_Xkh HZR>Wn)/f5xm}6֬~o߯kz2l|B}}nDMR~e/_sm2=i\VMkw;'>5 X9«.!;\mlmIyI>{R)(JA_j_x+x~l{ֳٓ^v_2l?ɺv6x2c<>2prޗ{]fLibµ۰pO8Ϋ܈nq8AU T*P@U T*P@5}%f.}^EɟqL~OɭU T*P@U T*P@U T@nč4N'T*P@U T*P@U T*́9c1U T*P@U T*P@U T*PŃ578i4NP@U T*P@U T*PŃ5sc1P@U T*P@U T*P@Ukp#nq8i T*P@U T*P@U7>^}zd|GF(H}V++j'$Gyϟ:*ӯ[^8stؽ.ym cPf6v|׸\vZ>ȣ3x{΁ekX{^b/iRt)]jP@U T*P@U T*P@U T*P@U T*P@U T*P@U T p#nq8i T*P@U T*P@U TaA@U T*P@U T*P@U T*Iq*P@U T*P@U T*P90}>FU T*P@U T*P@U T*Px7F' @U T*P@?W?\X2Ϋ.-L<İp.WN1;{,+cg7k%qܚg_\L[q\Pvs/VY01ǍknAU T*P@U T*P@U T*P@U T*܈i4NP@U T*P@U T*P~zGGFȗ/zd3ZYoU[?%9<{{@Uc*+u?$vϽ/u90l kϫV%-].EKqC @U T*P@U T*P@U<6q#IU{TW=&i endstream endobj 17326 0 obj <>stream hj&oo$@!!ʮkheB>oLKnb,9M}35]]]o?5k<bHej2ctQ in ,C^%BiCMUB}UC+Zhgz-}i LJ1ᣤVrXG1آ;VM55D7Sri[%F V1_|m͖A~w0Sqz[h#W8}g| zq_]L|/bZœ0ߒCцl}<4L.oz[)'Ujs}FUa|k1oUٛ*W%׬CGݵp%3tT^^*^Uۤr_U(RJ=ʯM5E륻uk6Zw_Eي^WRGuRb}䙼n\XۃuT3hnZY-M3xT1%uj5%0WP])^7 Sg Eu+j [^7iI6ߙe.,u͢MiexݦuC;ME2%yݤrmER1nKѦo*ڊ^7l{ݴez^7uG#2Lٱ\ۿ߮vO[?A54 = R/U'(ċ[po*-Hʎ5kljGL=GmV2L_}#~Rj/đ:Gq.^=i[d[tLgU}W ۋR{ؑυ~v.U{:O8,>욫<_ɾ$ !珵x5x8[w1}]T;D,au>Or!5M=7jU T*P@U TOQ8}>FU T_/$yKIQEaE^.ĴdG|ڮszib*5;XV]'5{/Y}s;yޕLn*' |*ë U T*P@U3FjD4N'T*P@U T*P@4N'T*P@U T*P@U T*P@U T*P@A4N'T*P@U T*P@U T Uqc1P@U T*P@U T*P@UkP#jq8i T*P@U T*P@Uk⠏c T*P@U T*P@U T*P@֠FHq8AU T*P@U T*P@ }>FU T*P@U T*P@U T*P5F' @U T*P@U T*Pqc1U T*P@U T*P@U T*P_K)Qb=9hE |{Kv+ss7Ie}_sx:2:É]ˮs8Ԉyu]P@U T*P@U T*Pp>F@U T*P@U T*P@U T*>AIq*P@U T*P@U T*>A1}>@U58i4NP@U ToT}p{Ri>%4J/e1da\VSrz~Oe tӵsx̯];8=|uxicNg=|Q{fn,9>stream hˎdGW7_$ .^B `p/TΛWqtq;8VqޖV;9󦄌ZFiۮibi8yShyi ݱKpO}Zrhя՜qގVyys:WMxFvޤǴ+tM"oK#oK(%BTͱ=؎nZMX7j5cڮq.I0#Vݼd4#Vh.{PچcVݑ7,=ؓX[֨%K87Mp9V nձZmե3n\VWGs,_TtG%et..[KvpMδU]!o]cǞyS8j7Ycyӌܴqrud^IutMeutt{%M7Y*sޔIFψWc]j5UcXn{P=7YrNqdGlV͉ՈrN]4\s'O4^ZW^\x_ݭhEKɣ:+`؈n;/~W=?y޾7w߾SX_=}~H!Ǐ~x"woo͇xO4cO什{_wS4!#:35hn[lk!~]v<-[L{2K+׮hkxTQx{ IdJL3ZqWܽ8o0U~Zm.o :7orKq@TATATATA*⠏cPUPUPUPUPUPUPUPUPUPUPU$FIqBTATATATATATATATATQ}>F***********5T#Hq8 (>FATATATATATATATATATATATATATAF' R1}>UPUPUPUPUPUPUPUPUPUPUPkFI*********5}>FATATATATF' T#Hq8 (>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPUAǠ b H58i4N*********⠏cPUPUPUPUPUPUPUPUPUPUPU|ji4N'TATATATATATATATAT⠏cPUPUPUPUPUPUPUPUPUPUPUPUPUPw_H5KVN endstream endobj 17328 0 obj <>stream hndEW9o_$VA## X6B:j\vhU]Yy2"s#yqc0C~#F(u+lt]sQ1*GeĨm.ǵ~5J1zvr-Y[[+bc׈-H3bf:V2)6vJ%P)is\#V 51l۽Gi9vإl;mJ7X/m6gKW4ΗXͶt8jű9M. )k)#b{p9m]jDvzpt6Nv:ȱmTMQgr޺fyMYX]c些2d+;Ti8oE}.v Ҧcj*]}Vn[e)M%bfym Mm3;o8lJc5lW)!=M2fy[%9oj؝s)鼭8y[Su>c5ΛGbi|n65XͶ=78ocI}#oQģ8oqQkmp{a=Fձ-m8Vy:icX6tf4 ]6bUCpE,{%:mɱ9E޶>;L,%e,qJڪc1[Bf-Kf/-KTĖ%s֙39#xL9J\Qxj9G޶T= N gm X){[yZI/D"o:3Hmϑ<f9o::<ΛJyW9;o⊫0ΛyW7iyZ-ttwΛ6y׭:oW-4Ye0bu[?ufQ jٚc5:c5.XͶvfiI:qQ=ݔS7+RbbJ#!Ǽ};cioVw|̫RIqIǼ+r7}ݏO勇?|rw Eӻǧxx?n{!D}>ۛ7?߾;]V|MǞxڮ JfWs;Wx/5\wnڭgy: [TUrWM잢jOT<^|&I/szW57/7͇H[:rG.cFu\6ܴsѱɱ!]~f J/k'*(~.gEΤ]Wyע<|/93We}g.{rZPWp~e/Suuu.&jY{],2{ ֻE\o3L5BTATATATATATATAߝ*⠏cPUPUPUPUPUPUPUPUPUPUPUOTQT#I*********8(}>UPUPVi4N'TATATATATATT#Hq8 (>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(}>F**************H58i4N*********Hqc1****UQ4N' 9i4N'TATATATATATATATATAH8c1} /P4N' /P1} LJ: endstream endobj 17329 0 obj <>stream hnc[;PIYYLl!#C##J:NIO~J5r94Ghh:J-۩q'Wr84zs\i)fVYvvãN.'r:cFN%$ȚS)=hxckMt3GkՍ>:5<'bW*cvjYvjcvll;76ͶrlllgWόؕjejw.o"um"9{1"v;)'buű"U]W&uzHV/^S%+"aޭs"c}*#R֕Rv*eE4em9V[)%i˱KMimț^#oCymJlkF޴MXE;65˳tl=R#ozT\y[ySzoR}GVIإ٦fDf[uDf[;{ Kl-j7-d;uJKN0P"vhVNy+#oJ3-()ܑVͶsM1NiS'GJ8en N'Z}ފ6%}tWC!g.ءnٴeٖOm hysWxͽ"tbqފHZ*IeDP*:#δjjfOí{6i3J5u,hM 5'b5Pjvj6%>b5>;b5ۙR8o2ZI:oE)Λy1#VoC5#V#vixFukfЩ|ފ,٫E޴ҽsM^j6A"o|#ț.s{҉r_YȤțPG75>"oʍ؏ɒ3VMY#oJȍ7}y%d74u,>oE83&H8QȝJ_?<߽{O???<|g9}{);zIQw?߽{] AWx;?~>L,M[лr+>h?7⽞_"b:MUϾow15=^?zĽm\Ϯn{,u~i=uF,z:3%荽Zoۍ_QJ߿jXg5ꏈϪ_/+ZN䵹EV(>+Ϯ.Wu} څw#i?YmߪҧWMeiFpgkۂ6$7_zPUPUPUPUPUPUPUPUPUE(>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(>FATATATATATATATATATATATATATAi4N'TATATATATATATATATA8c1TATATATATATATATATATATATIqBTATATATATATATATAT>FATATATATATATATATATATATA?i4N'TATATATATATATATATATAC5R4N' 8c1TATATATATATATATATATATA?F' UPUPUPUPUPUPUPUPUPEqP1} PT#I*********8(}>UPUPUPUPUPUPUPUPUPUPUPkFIqBTATATATATATATATA?8(}>UPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUTGy>K endstream endobj 17330 0 obj <>stream hnE__ .!%bG#sffDw}[;SWśj!V& FHvQ ie~c(VR(m6rmQ uLϫx^ m y#4N׭PfBuLkL jˮېfjnCFʞjnN횅6WU[uZL=lqnSKY 6Kh89.VF\;uCt z&kkK]7epLu[6TmVM礭-;OΟC+zT]7,5T3s/t3?2M7-ڢynSCEZsUmT?(emʹdVĒK*&Map($Z&] -r_ft+bl2zzt哛Wo.﾿͛?<7/o^]]&d}yz/nC|}yͭR|bXٻ_|{ysn~ҘtzuguDIZ=}^Rg={c;^kKOvxmU>=ͰKA5->&lH={5,{ecᦴA-;狲ǚ5{׉[Mco{//戟4s<>wxl1idېx/9RP[E[a;|we^<&n|?F*P@U T*P@U T*P@U|7F' @U T*P@U T*P@1} T*P@U T*P@U T*P@578i4NP@U T*P@U T*Pk0栏c T*P@U T*P@U T*P@_Iq*P@U T*P@U T*X90}>FU T*~Y78i4NP@U T*P@U T*P@U T*PGFHq*P@U T*P@U T*Py s`}>@U T*P@U T*P@U T܈i4N'U T*P@U T*P@5sc1P@U T*P@U T*P@U/FHq8AU_T%&l3' endstream endobj 17331 0 obj <>stream h]k$_ >`|C ^ e-bA,I&yJ^I$93S>U+vږV[zSYWjJ[Izfjj޻WecF\ZٳWmkkDRԹ{5KFëR9ms弭GSEUZs-m4.2zĮ-ג'-Ww%녗XeE͔:<[Xe[ٛUwe[F^[:X_inӱEgVKr̈u1>شG6-Sˑ#VG{s[5jslUc^#VVI֬]cFjZh.{~о}FC(O)gS݊V%bzgiK[{*[Ql#lGݚ͒9n5qvlW'ܧj4RVgZ6-WM۩2Jujc[ĮMu9RcGtQ7#6PGtF*۬Q7u{]iDuSTK*ڭfmMWGu͢eod"ocSSGrUGTrRTM6{MV-3f:R SMGԕEݴ]ܯINQ]7][#SV[6-gXe -ʦxl3nM{tݚ 諸nM ݻƍfVǝn0*nt,YXY޳jN変]&ic5~I?ѩ[KҢzʖSu_rkpk1Dp@1HpѣygsFuԎd]@RֺE%dRGR-ksƈM^1{܇ӿ2HWj܉yۊ.Ս#GQj9~9,Qs}tǛO~w|vݧs{7gW><>-_g~yT#OG>>O?~sᇛ7VQ|x;yӷ_ }(-uz{ΣԿ$wcK:&_|v8qQZ`cgN[{>q㚎G\k79~ϟWg?7.=9>]ǩ=ּ~wdz?pКϟ_ljwN⼑{ˉ{n{ݸևq|/MB{n/x;^inh7.U= /]G Sg)U{%>\ؐ8^?+UPUPUPUPU h9cATAT{TO}{nʙ~QM9?(=^mDZOz=3ԹhK>stream hOodRWIEE0Q,FQ}v_EBEOWOߪ[s;;o:':ΛСtjI:]Λ6YWq޴htǨy7u:ySF>oMWTGކR95ͶJm(*07mʣ8VFR²cäքRN7,4fN7}`bU:y>o]lʮc5Y.Ұ:obe}ɛvMHyc:ojyV+Λe>dk>5ñ#VN wwJKXͦFzj6]1bK]b9j6AXͶ^cMٹ/KyV pS[H7mϛ֤*ˎmϛz83j6)X&EٴuYp,&i>{@yU5WǛ/u^|9W548~8tG.cFu\7ܴsѱɱ!˻LJe̜t\"NJ*(׍~SU"~]ag^Wy/Eq}^?s>zಶkȮϯKA*PLו9 W = t_TF{3Ṑ8m}XUPUPUPUPUPUPUPUPUPVi4N'TATATATATATATATATATATATATATATAujq8iPUPUPUPUPUPUPUPUPUk(>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(}>F***********5T#Hq8 /P1}>UPUPUPUPUPUPUPUPUPE5R4N' hIqBTATATATATATATATATTQ}>F***********5T#Hq8 /P}>F***********5T#Hq8 TKOj endstream endobj 17333 0 obj <>stream hjd[_qb$!r|E,%#Ʉ}L@=R]kzVeTir֋W1?u+lGGk1ʩhTR1]cRoq=c9NS⸙fY[i⸝Vq9G̛KG6^cGekg-.bˡ[rʽ׈-mEbZfu9VncE>vl{Nꭣ#bkN%qgl9o[HFNj]\*]+8:]h*=i7Y M]8odiDMٝ7Ց"Vl戕%[YXmyY'ggNh춹ʼn :wʥn9Yi|@Lɇ:OFDtyn!Ƴ9>Zn{V$SwnHB}Ù.q'>E\b:U\blr#Zoq>W|eh s>yAWG48I1|(84r쳛_>}ro%|u>|ۧ^Qsooψ2o//ӏwo{M06zs!q%^qkaX~ոq~/E<7(^S\.(gyx;pv}}Ꙙ_g]UƩYq^qUY\Ty欙^H䭿kXmYϾf\;xyͳ՞\ۃ>N\+pyX " oPUPUPUPUPUPUPf(}>Q|q8 ji4N'TATATATATATATATATATATATATATATAH58i4N*********⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT>FǠ a H58i4N********5}>FATATATATATATATATATATATATATATATA?WF' UPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUvji4N'TATATATA 0ab` endstream endobj 17334 0 obj <>stream hjd_开ѩ: qb0$!rrE,%3 yե9x&΍]յjь:Y}so)EEcKLGqԶ.DQڎZGVzʎVs=խ=>o=%ts9FN6a]J,: ToI,ѧ\$ !ZWC[UXH!"X2J_Q֭PHCmBe>I GmZecRCm0Ƨ،N\i9T ) Y8ECvîPslCe#[IQ}bɜ% M?8?큛rupxtj03L]顦awH=:]#]V;-;t9ygB .:%((QJEg#[nya{qD9uW2ʡW^U*|ؖaBy{44רt^!.;ӫ\?|qx?\7w@v|uϿ~+7ox< ﯗ"~zǛ7VHB/G~_tDlA uD.TJ47T]^}ꜼVzT㵲?)*z2/uz\+r^ ^kZӺb-&Y_{k~e]Hd}+z=9(;:xZq\׾Y9|ølocz1=vz?n2sm.֢stK=.cyk.EKѥRt.s=U T*P@U T*P@nč4N'T*P@U T*P@U?7ύRtۥ0[~U T*P@U T*P@U 7F' @U T*P@U T*P@U T́9c1U T*P@U T*P@U78i4NP@U T*P@U T*P@U/`}>FU T*P@U T*P@U 7F' @U T*P@U T*P@U T*PhHq8AU T*P@U T*P@5 s`}>@U T*P@U T*P@U T܈i4N'U T*P@U T*P@5sc1P@U T*P@U T*P@U/F_/}{6??~4`{iOW۱hדr3zॷyXqs ^fy\߳Gɿ[9˶^c/c1W]\<+RXZ:cD)ѥR;U T*P@U T*P@U T*PDFHq8AU T*P@U T*P@U T*P@U T*P@p#IU T*P@U T*P@UW*́9c1U T*P@U T*P@U T*Pkp#nq8i T*P@U Tר1n endstream endobj 17335 0 obj <>stream hM\Wr)HVĈbaEv93GTS%֬)\cDu8u;S8WJwܓJo=rkVwl5@?+rVĹVrV[8Wm]uZ\vy96զ{DPWr"UnZltm=ܡPp{wJuܭp6jYO.>PWߑ۵.Wj:8Nu[,W,V%bj㭏\ovRZO=n+GRu:՜׳nʮjknCES&"7Nml͡PmL]ܕzS" 6O=" "J8rnK-j]ZmmMw--v7q4r9MT{Giۮiܸϊ리rnuKYim6ˌ\-pݴ*﷣qݎVj'n:q3~ncq|c^UnfL]k6VG'Gsn/sUfTOV:WuSKԭLnM=OBV;M*KteJ WvLPhi+ڈƴz0+QXnδf^sV[s9WmWZm\vz-R?Et gM'dQM w j qHܙv/ǹKiբ ck|{UM7nBM]7vt}릝=92}MM$u2Uru=uqt1.fqdəu%gu+jnC8Nqd( '&Nn.0Q|G ҩ!Krxxdqm~2pŠ\l.uՓk&cVq˸b]cs\H]Dt)R˵/; "TҾw u5|'`Kzb]ّb]M?uwsYO~o|xx=?~o~7߾_H2_?|_]*<ӏ޾SJqW<|_>LJW~z|<阏)~^O}bş9!ݺw%>Gq^wjWu:;95lwn1n,=x[vQX<֊Es^' x}㚷?#9J]㾁צ]'{Й?\9(2.J~xFU#~aW^vu禸?|-_s=ھ]uW/z﹡^4^|lz\ \ߋ=e?Y:กx/7蓮n*9hs9UPUPUPUPUPUPUPUPUPUPUPAH728 N*********`1ǘcPUPUPUPUPUPUPUPUPUPUPU|n N'TATATATATATATATATAAs0ǘc1*************;t#dpBTATATATATATATATATATATATATATATATATAH728 N********U4c1Ǡ b H728 N********54c1Ǡ b H728 N********54s9cATATATATATATATATATATATndp28PUPUPUPUPUPUPUPUPkhs9*************************/SE7ҍ N' 9c1TATATATATATATATATATATAU`=7 endstream endobj 17336 0 obj <>stream hM$R_LefE/mz5X֎a<]^-ʌE[[[ko=Vhneˣնvg?bGu;Gm;̸ce\lF9Emqs6[w\ٷvqne/yሌ<4׺24r۷RVݴ<Ͳ9ֲتlLVee63Vƪl3F**5cmXm[X㾺c[jVZKئūEF.;ة82V)7Wn֡l#*,]ͱ2VV jյfvԌ"23VQ3V6륯86-c6:6zh{jz*E=cxX3zcB+2g>sfBYPxڅfΙY6sf#cZN GXe5M:t-Ȩrߴ.17stNboz澙}"iҽDzBE>o/ڱ.nmڱ=END2Vٺ秡e2VfxucE΂-dP8V{3^2I:˒}e9gқ!EiTCe=Vve13V٦O6Xe |u+7 -df} :պ=cZkv Gؔdps#3:<ζ5qNQ_)Et CSdE6Q Zj;oF#wޙ4l+SєmTCO!8۪۪;Ɨ9c[3^yˑ52[CuS5FvX۳jrޑ 'C-9t쳻_~ۧWݿ?|?~Wwy񛇷 |yûOo~}ͻɣ#C~^UAW||;ᛧoE}WJKб7#\w/b\wzv5= Wy8~|pi?k{~\??|׹s>?;~8n\o,w}^q]S?lsu~;_h.h΂M1sUTYq9xMB7s.H^_z8 W8(}>UPUPUPUPUPUPUPUPUPUPUPsji4N'TATATATATATATATATATATATATATATATATATATATATAT jq8iPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPo'FIqBTATATATATATATATAϜ*⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT>FǠ a H58i4N********* U?-ʹXsoXs?}MƋ8y_ YUyp.)fnFM"K999k9^}^ܺ5xrZyCt)?8 WUPUPUPUPUPUPUPUPUPoF' UPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUTQ}>F*********F' UPUPUPUPUPUPUPUPUPUPUPk(>FATATATD%4 endstream endobj 17337 0 obj <>stream h͎dG_%_L€W=b1xZ%m͌x{Ή[Fb -nWԭS'({tk==L9릢jNnơ?GkH֮Zꭆq)(i*ii]>>u9=u|la gڎG3PCj5u[CJNmmQ6Mڢlc`fVN\wVCl{j󎲬U9i9ZRZڦ=}]oC;֕J)T6mS밶)۬ڦlpGS[hmGهXv} ǥm/o*R+RK[e.k^ߋ=c?gh_UX+ۼxRtZZ*B9QնV1sh[jv;vȵvŅv)v:ꦙ6ڙu&[5M:6K 9ClNZe۶Xu~lʩg 簤.ZӋgPS5B;tڙz?zhGV2n[c+lʶ+۲m*.qDd UCs}ڙdZ.hI\IGDMuSyLMDuݦ&-6!)G 'HU6ZeVٖΓBm6d[a-tj;5mKĎ:^r Z WhE8 w-OkuVg[ZdM-piU6MIFhMx@ Gvݦ(GaN+Wmjvʂږ4/m%Z q:5++&Z+,ZmRk5{ZM^GXig jdM۹EĒ]rM,eDT&+eok5n-&5]ሺ +SM{*%{Q7duK.Q7d+v- cKN4P:53/Q>!Eq)YwӍϨt^9ΫCz#8kza(t]gW B .GTR(^QK%\nU$uXp'C[QPMF*P@_|w,Y~We䨟tdޑy܎&ݜb_={VF٫#1=<׳'Nu߷ ڕV >~S2 T*P@OFHq8AU T*P@U T*P@U T*f1}>@U T*P@U T*Px7F' @U T*P@U T*P@U#nč4N'T8q#nq8i T*P@U T*P@U*́9c1U T*P@U T*P@U T*PŃ578i4NP@U T*P@U TNq#nq8i T*P@U T*P@U TaA@U T*P@U T*P@U T*Iq*P@U T*P@U T*>F*P@U T*P@U T*P@UFU T*P@U T*P@U T*Px7F' @U T*P@U T*Pxsc1U T*P@U T*P@U T*P@Ugq#IU T*P@U T*P@U T*7F' @U T @_ endstream endobj 17338 0 obj <>stream hjdWc$!rrE,% yHurl6险9ݧS e#Ԗ4zJMv*MYsNZ~U}TS/u>QOՈiq3Q"nGV8K+9mw+5\|]k vZXQS-bu3ݴ#R{lZmyll3/mkmm4l[wCf9Gf3}χڼ5lڽjki汭Z4]{^{Ď~_Q{R3plFtuHPW5R]#VYiȘϞ{̳|}Vf$[R#kuGVZG=GFpy<"Vg<+Gކf[#6,cE|G|fR̳ElW}z4ySvmaKEަ%mtme WMFT}XmylDޖf[sGfSJ#VS#Vۈ-KCJ+)ePeDySvu"o}O͙fT\7mR[["oٔ&3l#oa+Λ^\#oڗ-&=VZx޼SVLݗ7{ݿzO_o?~sD|u|{!wO?!f7_wwb{].<<ގrOUM!ɐJuT!Xxg8q^uW :Ɵ%~ͯ.G4.]3_}" 獋Ǜȯn^ٶ<2g,5/~3}]'C Uq~:'sE&wc~f./HJqc_U|V ;v]^/Eq<^9^TpȎ=9?{)B8ً\yY5Z|V*\߰?.z#4T#TATATAϙ*⠏cPUPUPUPUPUPUPUPUPUPUPU$FIqBTATATATATATATATATQ}>F***********kFIqBTATATATATATATATATQ}>F***********kFIqBTATATATATATATATATQ}>F*************************YPE5R4N' 8c1TATATATATATATATATATATAXC5R4N' 8c1TATATATATATATATATATATAXC5R4N' 8c1TATATATATATATATATATATAXC5R4N' Kկ~|EOs{]b&Ǜ8qKըPo<n)uY3zUs˚k׍5>yv.EeĽM>k8FATATATAT675 endstream endobj 17339 0 obj <>stream h͊d[0}?m4 XH Va|:=$wQSYUQy2<T;#GN1):bRa=]7Rq35}\ۚ6sD\.iqZZuTiyhQp9Sos8"V rޖJgĮmmU 8ony[Cw_sp;okއ##;o*>T)PKlZt}_@Bd{q\`O /EMN 4HQ]Y=ꊛW7yEOc.,wp5tqUj"JXEl]Yh"MvlEuq"Y2 +ѳdNg#bu,UnEupQԎjE ˒\*4 +* j4be.,KNJX]d- [l4N١Hة֗5\i6F Y GY>ZmiZgjm y[ Ջ&KTEΛ2n Je8oDy%ʚit;o:NIvΛ,٣jVW{ڳj{1F3be%nl٬ኛ7Um8XM@=ptѠs@UUKUxvNuvgw,uWvgfv|sҭp8+Zx8+ھfx-x;Fw*"ogxwXwttǺpRw;cU.'w~wWݿ?|㟾ë=~R̗w_<}߾~]|w_}[d5bﻯ~}JfWOuS:ezC:eMo9.q1zӟ]O|yh@w:19'Dv,(׃~QU"~\agnq(_5~G窽,LϞ _C1ջ׵Tq  ==M%UPUPUPUPU FIqBTATATATATATATATATATATATATATATATATATATATATATATATATATATATAկ*jq8iPUPUPUPUPUPUPUPUPUAǠ a H58i4N*********⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATATAAqc1******7=͋,?U/KrԏVd"obvpy!=WJTދ+{fCg/ny}g_?Ν\L}?]-lپy>  TAfi4N'TATATATATATATATATATATQT#I*********TQ}>F*********F' UPUPUPUPUPUPUPUP9i4N'TATATATATATATATATA*⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT>FǠ ~T[t3 endstream endobj 17340 0 obj <>stream hߊ\W"N $[!yb yfZ "'mԞ:S{3rje4zLjNնjrk*ɆBǶ,W-f+bԈiq+U#nզǕv.WJ}xRSɵx`1-glז#mGHz+-b46wTts[{{lUckIeUƴUi+bmʶXeۥF9#Vx.k%鞋ZM8;=?ƻQۋkUOa|}[w]wO R\/o mÜ K9_ FdpBTATATATATATATATATT4s9*************************n N'TATATATATATATATATAAs0ǘc1***********XC7ҍ N' 9c1TATATATATATATATATATATA_F' UPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPU|wn N'TATATATATATATATAT9hs9UPUPUPUPUPUPUPUPUPn^)WIVr}Rvuz-K@D|mn  c1ǘcPUPUPUPUPUPUPUPUPUPUPU|n N'TATATATATATATATAT9c1Ǡ b H728 N*********************t#********Yb\ endstream endobj 17341 0 obj <>stream hjl[I99PE,%#Ʉ}YK{$v @x1险Yݫ1Xrm4zJ%[Nz9݊Jj}U_N猸F7Ұq3Q"nGYZDNШd;{>cfUJiFDTJ:4#bg*ʹ#VwӦEN4YC3j>l3/mmmYXfkjsjPoRoڽlcmUǶ}jء.Ùj=bW#5 gX6XEiW7rk6mHvn[;S=RWj5 g$ji.챺zmTUIጼhʸCCi_T 5ʑ٬vśXmr۾Gjs6*<[vOXE־"VkJMù<6U9w=ߞ#o^3ψwW"o^Kfy[m;\"oJ=V9JH[i8wa:h0Vi8.ShYc s:2cbk44Dic( [lyGiHYF7kڌY6ּ4r[q /F Kc"lCͶFXfKÏ״1&혗бշ4ElOFpz8WK0bW%bwZ2cTZdi=VJlz;b5M%k{4xt|4#nyT mUz.[ء;ɬ]M%lAyΚv$G'[5&KL㱲ĬE޴<ySl3\#odekiyӽ#o3=r+@țXQvyB.VjY#od "VyUyWUvfXY;Nv~4ш"s$p\Pco'rX}'5z]=^n|#]"]3|^+[BPuǫ44:KQ/G[Eo{G~6F6{lq Rz!c4^q6:|)>׿}U"]=~"Y7?}wϿ׏>~o*@~|}/}Jƿ˻O?<>)Dono//ӏwb{].yx;/=Im7ϜtTՉbywuR!Y?_ V˸"ћ.eOү[UU wW}rR)xc;>O z}Fu3?%Aqő8d(u}:gsE&wS~f./HJqcT|V ;v]^Eq<^9^TpȎ=9?{-B8ًOR^;spxmGfs!~~}ZFi +TQT#I*********8(}>UPUPUPUPUPUPUPUPUPUPUPPT#I************************ϼF' UPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPGH58i4NV~rEi'Ų}V,_x8u-m׸YqMvtXq'ng^t.^]Tq-_ybo&~3ATATATATAAqc1***********lji4N'TATATATATATATATATAAqc1***********ji4N'TATATATATATATATAT5AǠ jq8iPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPU_~T#I*********SEqP1} ?F' UPUPUPUPUPUPU6U`I' endstream endobj 17342 0 obj <>stream h͊d[0 B  1/Qc5X3bʞ^x!02OɈ|8}rc4GRF+kG;ն6sNu⣒XG5RZ"jčkFOQ"ΒJe=ǕJih#"sXvΤʹ#VwlGN5k/@-c4MV6Efjl׈lk_j]jjmkڼ܊25ZFVSezlkZخ=o#bGlTk#vih=b5X`{ll#[]̛,'V`%Dj20N2Ě,qE%a5*4یfX]SƉ5YbW9lʼn5ݫi5ێ$\X-E8&KVGִqƉ5Ǫ&fةaX֫b ?c:tKSȒe=PJ1*w8j&K֮9b5^3bM+,zɒ]cndks|dn17ۖ5t-"vjZj6Qj6UXj6}kК4,ٻGi쭊z@3jCwXt#WT8Qj#4aԇHcFg%EhDhQ#N}Wn>xW>j&}[y7hE D -2)]JQx\.uD2X5>Ho 4●w$T[pϫm!]}^gHCϫ-/~W>޽zß^7|uo}N|}To~{߽OuCDT槿?Wwy'"vׇ7L?MC]>nnUk9^b}bT S{=_"K_v|^šϻ_\uyŽu=g.<ή?o|׻nwӯ{?\/qA{]>2Ypqy/QJ_~_Wcl5JOq^(kx"%(>)^'\?Ƿ)NGn/Y=mOߞħdzȟTƺw ߿-!qy?z}>F***********RE5R4N' 8c1TATATATATQT#I************************1/jq8 ~TQ}>F***********jq8iPUPUPUPUPUPUPUPUPŃ5AǠ _mQ9>WkgbTkIٮ(wY,i}***F' UPUPUPUPUPUPUPUPUPEqP1} ~6VۧE^~6}gOTP u-gL9x^7fn{[#~okXm6.kϸ_|nzs̓I]܋<{u9cR,ߙw&***********8(}>UPUPUPUPUPUPUPUPUPE5R<~<D@7x  L58i4N********UAǠ xji4N'TATATATATATATATAT` Aqc1***********F' Ux#PD endstream endobj 17343 0 obj <>stream hjdW/T_8 xD,%#Ʉ}e84]ݽvU6w?Go9Yoj<>J [)e|Ծzr1GcƨQb4ѳ1Sw:̎*=r:Nvkˑap4G6lv/;֨)ri۱[2nXGnElIZmFl#͈-xX6tf8V-u 5űmXm^9buVXa=Gl-G)Gljkbش9{;zo1Gi;vi8ێfŹ fa6ͶrlVjcQSsʔtp8i2"V[_rt+ԈX%Tmuc5ۨΛju6ǎvͦ,D.^ڱ^mry2KiEP)ἍXQiPV6y-nM-үSM65[\Λk6F=omjݫcSvޔ:o]u]U-3MQNmanűSu>c5Λc:o[mͦ49Vi}OMG*Λi;och9v[(#[\|yDm2ZmEmkgGűmXM1vq&*j6)4T3mȞN3G,6 :cfVϒcVqlYɶc.Xlza>7: NJX2G)teai ElűM8:Vڱmmklnx,*C-K_fZnՇD<Ɏ莝,ѩmE<@wu ^kU ZZlxW'B/u(Λ,ǹ ƵCΛvVw}Pʡ5;oD;odhtޔ=ۖΛ.;od弩܌XVEPyqRin1ΜΏZRusdٓ(OO'2V?UQGccwΘw6'qƼs;3DJ+::oR7sΥ|rڎw[rv>W|eh 2LvFwէwΣ`7`c^8;q̻?n|ywonww E_d߾G|u?;_7y3~W.UO~x/\zYp|-xxS4WM#П%+nl MXuS_7*Bs\+6<ίTE}]>{}׸sgHBT_{yJՃAy< UPUPUPUPUPUPUPUPUPUPUPJAqc1*********jq8iPUPUPUPUPUPUPUPUPUPUPU8c1TATATATATATATATATAH58i4N***********~XCqc1TATATATATATATATATAH58i4N***********~XCqc1gjF5qPUPUPUPUT]$ endstream endobj 17344 0 obj <>stream hO$Gᯒ_MLOwaHxƚ] y$h;vNwtEUE}n{tHX̔^jڎN#8R=ZUNގUMm+긞ƱVb4rJsڌ|}91#.ה#0-pdӹá=r -X]L-ݱ:cwʭ-{Gl)"(+bl.*:cm]blT*^kR7h%b둊=bkr%Rf곥ئ{ަc{*-nCLñK|U2Mv;#).z)5eS;TjήnQ*W)kZWgԸ-ntqZNM_^ern]ȎU]7Spݺ e[uʶ6ԉj1]u]1Եm:vVkuLǪ[uݦvHۮIuSmN7Wt66mnm*ñʶu\mn+^-:VQcuO;-x7alqFqb[[ "Ϻ4A}i c0]iKxؼY~(o4A CcY\ -km")QK!Hs 7ANUF,*rdQM+ * 6SmUbn,Kfq,Ms&>H DeM ~tdY2 ˵ >0 &ȲdN7Ԓn-3U=rD]]9iG[%lq)hŲUvlrV[c:v[-X#D=lcnd7kؼY7yl;ʶgv;vjǮKB-|ekG.{k0u%Gײk9\7}V4*Xi.Uund:dVUA6bCkhBrD҉{qrtu;^sG*|"E+uxqgL]yGs g䝇k8#.⌼32Ȼr]Hmta?ťzz+Flٮ.-]_rAEOuEWK#aD3;ݸ#.뎼;&_}O>|w|w}ȡ/2}㯿{]|7}~ӳ(񈼑oǹ8^<>" xy-qq}kq/s>xxG=9i{>yx=oN|7"h{&8ګ{}:yߢT~(_uޟof6A򼹷Mq)qyiqhgyx;nlxZճ0KWƮq>㦳j?^]T]r^:%Hs+{VC{>Νyg%ONyݾ]Ю/վy>kn5_b UPUPUPUPUPUPUPUPU`1ǘc1******⿀ҍ N'I7ҍ N' 3t#dpBTATATATATATATATAT9hs9UPUPUPUPUPUPUPUPUPUPUPkFdpBTATATATATATATATA?9hs9UPUPUPUPUPUPUPUPUPUPUPkFdpBTATATATATATATATA?9c1s Ѝt#;I endstream endobj 17345 0 obj <>stream hn$E_^9$B0 k46B='+x W8EGU[jmkXзh-2-[S–C)-Q-J[:IrI2,El]7b 6ŴŠ, {ue\tiim1ZLŵܧM3-\L94Xk6mRi]=*qɵ6jw͘\lwjB0f7MT+L7ph M[e\n5mhښfsUl6ߪl*[յ֛MP1nMf-mrb^7XBieKL^7ʹukM-^ַM+yTRM]ZiuZpu*׭+(^l3zݺuuu2iڑ|v L>Yus ݵ] S͖Em6nezMefyF}k=O&0B;N&Qڶb;_aWAbɨ%V4;,Gk3mmަ">gY,#{4M,"k6Ep*&5׎MUizr[C,biuS1X2s uwZekŒ)VDp6<`|0Q}' S7X2Ep68!{jMzT(x݋'D}ի'(^>TT#21j v|ny:ŖWw/-n'Xޙx%eZ,^KEm5y1G\oV\Zpๆ=2kWKlCh{ bۃiyM?-HiyՅW^?|vtw_|7W{{?>l_^}vxeۇG.R~Տ~7?޼[ z#}s_ܾ{[kv>̈` jI~_9՚pRiGZ>QϏƳ^;qk>kٺK;{C㚬|8):i|8v=^[yleƞ(ZH&b7l,yDž\)J'nLtх|݌3&B=Tt6:0vk|ڌw28ܫ cgWڮ8|w9'R"W0g vh >^;noT*P@U T*P@ 0栏c T*P@U T*P@U T*P@U T)p#nq8i T*P@U T*P@U T*P@Uƍ4N'T*P@U T*P@U T?Usc1P@U T*P@U T*P@Ukp#nq8i T*P@U T*P@Uk0栏c T*P@U T*P@U T*P@/FHq8AU T*P@U T*P@/`}>FU T*P@U T*PGO߿d0Rd˯:2vq!lj7|{Hgt6UwUFŖwqʳW%<ega9}GexUYp#IU T*P@կ\۷GSAb/M9^%,˱bxAiHүeFU T*P@U T*P{Pߖ* endstream endobj 17346 0 obj <>stream hn$W7`^*o/Zن!H",.D  Oiz![K?NvGWfeD~ԽrmԏJыTf1ک#qĨWQMގQK\8鸑ƨi鸕檎iq%S#JM%6 gw䡵svH۱VnXݩhq[kElͩ"jgV6fsbU]Vq[URV"Vym%KĶj-;4W[~ǎT;SUpl#`Rf;bͶuh5c5nNv;35m{XN'MSZ5m}DlWiy551b{p8oZ-;Fwt65۱mmC~z*1C#~7Toy3)ͱK)M,MvfIKTC665Λ>w7U}ju8oSpb!y,jR*޸V8'ڱ3u]ͱz-h1X[Xl+;o1[>cuyyӢGΛy ݦZ.A1li(c-G,v W[6fnlOjUk*Mc[%: 5be)eN[M,Jwl7O^Y2kZumJ-؝XGXFF,ɋumNoB,ͱmXͶZuf[;뤹=ypF޺,щ+K[׾%;k8cGZ"ɱSyS i"5&KlqdySΛv@~;oy%;WM켝7]Fu޴MeU5j9oD8e8PG1jWcنr 5ٱmcV '57YwAp9o#:NA*hDΜ4xJm iZhgOXNHx82Y'pF!ϘwNyg$ΘWu|̫,8>Q=S :19KQt*OR uXgsEm1b8+~eJ׼EwdtǼ,wV'uǼ1:⋇߼LJwO?>~?~㻇??H/2_?|oxC|w{}˫BC7?_?=>{/y~5t_}VUcZxs;U(6=x\׸s:_׏ׯ9~xx> V˸xRhlz.\p-w/Pp\74j=xu< Zg|L|\|S_ qkӮE&džOnt19'(Nq*񨷍~SU"®WuOܒzkqݞzSAs/>\\BzUYqZHpc}^F^4k *jq8iPUPUPUPUPUPUPUPUPUAǠ RT#I************GST#I*********8(}>UPUPUPUPUPUPUPUPUPUPUPkFIqBTATATATATATATATATQ}>F***********5T#Hq8 /P}>F***********5T#Hq8 /P}>F**************H58i4N*********Hqc1**gjq8iPUPUPUPUPUPUPUPſ9F' UPUPUPUPUPUPUPUPU|͋8c1TATATATATATATATATATATA_F' UPUPUPUPUPUPUPUPU|8c1TATATATATATATATATATATA_F'7 0PP/ endstream endobj 17347 0 obj <>stream h]k$_ ^"/@!ZĂX2Lȷ N?fPiOMS36Wڷ7/ƖjnyJ] Sjjͫ>Wekz٫1#N!dF9E޽#6Fͺ;.m8WeIxY="ZVv[.=z7u\-JrE 6)銎-ʶ(ۨ(ۘ+bwߥZTf*Z2[86-%e֪>"鞗]˹GJk)bGuRٴ=6eW~۔mfWeo6ʶjXe[Ej[ͩFrvPwRcu_jSk+e-EK=FDS&+<l#+أn]f4UugĔnZ1mkDtE쮮m-b+ϭU9-ZiOXզuʦwP6m:bm6FMf+lsE݆-iRJ3TuKͪq΢nuUVnSSةe{Gܼwۇ?~w7yx6״}}˯}w|y|y!="ʸ槿ǻwO?ݽuѻtw/?N6\kn%6;b -ӄ]}Wyˏc퟾^`sz8ms1ӛ=x/nu?]ן{r׻>;Ӯԏ>縎9׍?bzyĸo%<67Mor=}q7FQ7fhk=7ťǹ)>jknGq}?n/U= ү]SqۣbYJ|t}ћŘwGs7$_z}Ms@TATATATATATA U4c1Ǡ >'Fٍߟr3Տr~r~+['qc ^*ѝ1o#?n1'5x7GϜ{rH[=my>yڣt^t.^ky{>Θ" <UPUPUPUPUPUPU|m`1ǘc1*************F' UPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPG7ҍ N' >wh9cATATATATATATATATATATATndp28PUPUPUPUPUPUPUPUPkh9cATATATATATATATATATATATndp28PUPUPUPUPUPUPUPUPkhs9***********5t#dp28 /1s9UPUPUPUPUPUPUPUPUPUPUPUPUPU|ndp28PUPUPUPUPUPUPUPUPU|`1ǘcPUPUPUPUPWE728 N********)dp28 F*c1ǘcPUPUPUPUPUPUPUPUPUPUPU|ndp28?/#KQ endstream endobj 17348 0 obj <>stream hˎ$WW9o~,/xكX ½=Ι_VNUEedfEruFi3=+7ک~buRmGa;r*=bUSDZj8Zb)ʌJ,VqI͈+9#N1#Ter Gvk=>mT3EJwŕhyRGlZ:2Fتl숭6WslTθK3Ρ*)ձvyaj#b[IZִ\ٱ]v~T{]|\Q:Y]+]`VW6Èʶ륨zZs){ˣ:vحtєַ]6]庍t]ѴuGܗ6q Xc;VU^;buT'Mb쩗L{ٮ*k_]ͭ\={7,-eu[6U\7U6Աʶ붔X<- Wظ\]<5bwKm{nՖwK绗u;1c,[%T\S#4ɱz}vnڱ׹ncIYM7kEϺn)iu;D:"dËء媎Uٖcme-mu;4uGev^+K93be2 --gZ zn}aMǞzx@oGQ"Gqbe_op9V\U6qXexZ*ձB2[$GnG]qDi7'utl%;vhcgٱK3q8K;uS'TfL;~n:nDWut;u cu%:;MخjxM=zrdIuhxT *&MĪ䨺q͘8pJȕztZ];yrt#i_#K)E;+'֑wvpEޕ]ytWսt|e\WtF"t)=ŋ˵/z6b]3 S^\2 4Ήs'jE?KCq;xw<ǿ}~o<ݷ{zWO/~T;z|#Q7?||x/ݓx|/Mliؑ&Z-vEy݆xqz[ZL8>Qy#TZs/s̏1}|~~]ms=xGĭ{r}>wx|eԟNz"gKp^'\t7z/LSv7ٍbnkϮѴ:jx絪Wab}_]W]g)r?xDk sozIs@TATATATATATA U4c1Ǡ F' UPUPUPUPUPUPUPUPUPEs1s Ѝt#*********9hs9UPUPUPUPUPUPUPUPUPUPUPUPUPUn N*********~Hs0ǘc1TATATATATATATATATATATA?F' 1s9UPUPUPUPWE7ҍ N'TATATATATAT#FdpBTATATATATATATATAT4s9***********5t#dp28 h9cATATATATATATATATATATATndp28PUPUPUPUPUPUPUPUPU4c1Ǡ a H728 N********54c1Ǡ +eb> endstream endobj 17349 0 obj <>stream hn$E_^9 q" qaf6ZUS43rGWunasbAbâQEsK5䭅J(nI(m%iQʘP%pR亾؃Ec#nntŰM6[bbHф1+͕e-\Z[Lj8ƎTӦ5Qa+Mr0mR6kZe!VFUkmnsЊS(ɴ9(bKiKMϦ4k˦k떊[aSXkkBMBekkUj-֫W(-Tѽ^*iVT{6U-8\;ڹ唽jUHVe\nʓKis^7?uUUekIn{UnMƘm6׭ɉ*W#нn٢|[U8nɵVrizEqJ^7Y9L& KܕMjIˊ*[MЕmnM+SP,&:J&n5&Pg0PnM*M0Nn-'V%u7PNek V v \a'Сc`MM`ybi&67O+-sPzT ښk"Fs\l|բ6hèV5>M3}s O:D8\+h%BQ+MyiU^Y#j&FKzfu\lݼPzmFZe#Vf6UaGX2ݴbL+?aٵE̮0]D\u؆,Ze_L5iE |u҆ZeFK6M3ڮ{tlFtT8n*LenbuڋkugyX2(D\l=u*vմM+nbz׭Y]\,^9K.^:N7?ݨ̍sߌ=f 'g)r}}+lQvQ}0?fmv:AU T*P@U T*P@3 s`}čIq*P@U T*P@U9ōIq*P@U T*P@U T*~;9c1} T*P@U T*P@U T*P@578i4NP@U T*P@U T*Pk0}>F*P@U T*P@U T*P@U7F' @U T*P@U T?0>7,>̫Ԟ[:2w;"./\6s٫e]hw<{vy<1Μ[yUŴ>{r/>]4̓\P@U T*P@U T*P@U_FHq8AU T*P@U T*P@>F*P@U T]Qѿ}}6$){5By'Xg6v|;{Jkѹ Rc,Z:cvI ߙw&P@U T*P@U T*P@U T*P@U T*P Iq*P@U T*P@U T*P90}>FU T*P@U T*P@U T*Pa nč4N'T*P@U T*P@U T*́9c1U T*P@U T*P@U T*Pkp#nq8i T*P@U T*P@U TaA@U T*P@U T*P@U T*~Xq#IU T*P@U T*P@U s`}c 0;/ endstream endobj 17350 0 obj <>stream hModRU%Ă$`,"6B|{󸯧/$_}ܧns3Уre[L%^j2NG ;rNǮ%VG}XXr\[q32\vZuD\iqGĕ#|,UٴזSQˡȎԣXj܎ݩ#ZGI"Pc[r}e[}:VٶvKes:Vkت{DP{.[#bkrf6y>~ǎt;\ZXe-~"V=f۔mKWuۢ.XScGdmc=j.RV@g-K[n]]Ҋ֋_{u<ȱ6֕mXeuaU]7y]uʶ6rv -OMkptȭءmۘRkr:bfةl̈6fqR:s*ñʶ6mM鹺nz^*?#VUmmU-릫pt/vcf-Kz7.-X*~T6Wne|,m#b1l ul[Ƚ8V2ÇشVucGuoZ*ʒJh;VW5nՊX}k[c9VV܀XQ{!VsMEr65qű#Ӈc~6ñ;JW7T#VQ*riMO*Ԇl3n*-mn,*cm[ܣ:VHud+Kۨ[%#VtO9PMˮIɊc;v%5jqFU\7Yfsݴӵ;mẩs.`]Dwueh]ZvMq՝Kpɀݺ&Kϱ]i#:2MٱʦrVe^uUin{n#&N.)Y9zt:%5puVA_kd"E~)pƠw4pF^5#.⌼32ȫq*\J8:RJxuv-urs|XS ENp=WЖoD!S4v|%ݑWD\pQwAF; #}Gon?~ys'O?ۛ/2||>r?ۧ/}~x!}{÷7o}篟nȺ+G^$iW?#ޠx>/<*#$W^^sz~Qu1r_|n͡^sh|wvn:9$zБŨg\y>wQz^%׳#~agѮ|MqyZ.?s>5weg._kC]5/g+.s6a6z~=wK_TF{/ṑกz<_4oF****=F' UPUPUPUPUPUPUPUPUPUPUPUPUhdpBTATATATATATATATATW9hs9UPUPUPUPUPUPUPUPUPUPUPkFdpBTATATATATATATATA9hs9UPUPUPUPUPUPUPUPUPUPUPkFdpBTATATATATATATArJ7ҍ N' _9hs9UPUPUPUPUPUPU/t#dpBTATATATATATATAT/t#dp28 *`1ǘcPUPUPUPUPUPUPUPUPUPUPU|n N'TATATATATATATATAT`1ǘcPUPUPUPUPUPUPUPUPUPUPU|n N'TATATATATATATATAT9c1Ǡ ` H728 N********54s9cATATATATATATATATATATATATATATATATATATATATATATATATAT?`EcG endstream endobj 17351 0 obj <>stream h͎$[;#!acyau7|ʞ`o UQ'"hԨuyZGujnkU>j_=VhXգvZ׏FBzvTeW'-˦KnzKewzSd׭w-}5*ձ6֕mCtݴu7Mm^u݆Z1 m4gvFrn뺍y4űK}hr겵rݦom*hT]7auJkkoWvw>zʮ REGuS{I*U-gձtVxZN-(UG*eu֫#bu)}nm+ݱʶKݱl;^K]kھߤ};V[LGЦFzfDzb5{+Z*ۨӱ6Suޚ}:VoR"VhGFT^"]خS fݱBX)"V 4UՍ4{uY2ue.-ܫU9Wʹjq|u)s')ψUk4s_Έ-}QǶC$v-G-n;\QM^%:R1\75=#V[qXuűةna%n:]K,unD]ێ :k])cmLM\7}`ή,1qRu>+G>1Jqs:^@Ѯ.(k;]>pdJNxAח+8/%W=;u:*ȻVw|uwoR.YEZ4V.#\1ckw9ELΚ_ġ7"~Gu[#nߑwNWuG\yuO׻w?ݿ__=o_xA"/3קgd|׿|=r΋?>k:/;?%n5N" |x/1ܾw#<?^?M*sK4n_.I1.9 {|T˝^8G|UG.']ro~>qK|\L|o>n͡[/7㺁禝'^^HbTr.PD?(ףģ\7>;vەߚ\ܵ;Mv}ݓ󽷆iL1]s6p17'z>ݻ׵?TF(y"qq$n7|wHK7BTATATATATATATA*`1ǘcPUPUPUPUPUPUPUPUPUPUPUOTэt#*********9hs9UPUPUPUPUPUPUPUPUPUPUPkFdpBTATATATATATATATAT4s9***********5t#dp28 h9cATATATATFdpBTэt#*********/$1s @7ҍ N' ?t#dp28 y1s9UPUPUPUPUPUPUPUPUPUPUPkFdpBTATATATATATATATA_9c1s /Ѝt# UPUPUPUPUPUPUPUPUPkhs9***********5t#*********54s9cATATATATATATATATATATATATATAH728 N#yP endstream endobj 17352 0 obj <>stream hOodRWIEH`,,&`/mzzXDJ6q>}O:>gwOG}[L9ZgکԭqcSǪˈUMmz-멯Qbʎi4gvN^>&KEձ+is=QC$Yrd`sT^c\8V٤cMcMsiDnɒs+:h=\:qR\;yrJDz'Rų?c +c;3'/06?#*⌼k3y5"^jd%p%fGPh9]Km\c!\juzsn\Wa).hyE|ȫ#wUݑw XG^=m;}޿z?>黇ǿGϾ]/>?bFȗ{}^ݻy]>"?v??|_ JaWϯSԌ |/{y:;o:gy~FLƓxݰ/>up.uUAyU#y_uYyKNosz7O?͡Gezw_vn:9xF!FU?+{]zxAUׯgG΢vyoMq}^?sgq]ޞiL+o9_e*}HpXC7ҍ N' 9c1TATATATATATATATATATATATATAT@ndp28 M7ҍ N' ~T4s9***********5t#dp28 4s9***********5t#dp28 1s9UPUPUPUPUPUPUPUPUPUPUPkFdpBTATATATATATATATA9 = endstream endobj 17353 0 obj <>stream hj,_@U]` _%!'"B-%#Ʉ}-L|܄?C{t]Uk׷tն[u0uS$)m%(ohߪ;*[3tukom6(u8Z,Ϝ9u9ozf3[NX¾BY5׽)3}{CŔ4CՔvm^Ie 󖛖Pz[ =VƨޥZeVٖP9p,kK\yMkKVym g mZFhǶTB;Ze*GV#CP䶵>5Ce[VV_reH_[-LSu=Mk*caZJ YEJ[k G֔M)Bhm)+[W6eV*kor՜÷wWm- T[_[X;)jXmoCt|Oņ]'cKD-@C#zZ=j:p*[Be-6H^Y~yX1% ,LZm { mƾ ZϭBQڵMڍ%F+RRPlUFhm=&V٦GWl )gkbkVs3%mK5*NV5mK"+}SѷvZt(khM,J?|Sը7=R1ob*|S<7mno*AC;7|&h b"|ZTVمoҴM"ZeŴt8VNBlWjgfcXd:iktoO 4?+Q9 'Y tt0O@ɩpO+ΩO(n៘SFF~Dajw0q8,$w^?W^=Kaи["j9bwC2.PG *.-<];rWGvu?׷w?>|wۇ?~7}o/2_|~ٷO[g~s/OQ nO>no/w"xý>nG?_v#4M[xPCQy.݋vVUj(Mqbc_|xz}98{+֢q\9/s~e8^|x8S_q|?ϋ^'mXYw^%<'~?&q=3MOjwոNjq|"^(ճԟޯ.h΂Ӯ_1~JϞLWgշ*-[/JDч @U T*P@U T*P@U TRQEqP1} T*P@U T*P@U T*jq8i T*P@U T*P@U T*P@?8(}>@U T*P@U T*P@H58i4NP@U T*P@U T*P@UP1}>@U T*P@U T*P@H58i4NP@U T*P@U T*P@UP1}>@U T*P@UN5RT#85T*jq8i T*P@U T*P@U TK>F*P@U T*P@U T*P@Uji4N'U T*P@U T*P@U T*P@T#IU T*P@U T*P@UUA@U T*P@U T*P@U T*~XC5R4N'T*P@U T*P@U T⠏c T*P@U T*P@U T*P@?F' @U T*P@U T*Pa Ac T*P@U T*P@Uꗂ 0F endstream endobj 17354 0 obj <>stream hndG[@_%E9  Jq80X"3q|soOL8!t{ڵV=ˣ{tH̔^hڎN#8R=ZQNގQMm.5]:F8nV3ꈸ|QN%ej8#ZCؑri۱cc9V7El94\+bKNEbEYf]qSE]Vl;j=cyG˔c9s֒J9zV ئ=/-֫5;vZsL۱KQٴ,cՈlVl+Vf[RJˮNviztT]؝j)Κ#VK9or^5[oz8F?ټ 5T P-}PC]#vhݵ( U**c6Ƕrq޴ҖwuP6mj]Mij8o֖6sj:(ީF\]C6϶Ycc5cvަfۣ9vX%ˇLs۱UR/٪]Z7ekO9ok. -hFc9o:2}Vmku8oG r޴}m?k\;5Λ=rw(9Ntfhޘ"5t C91ihWw [=w#0ͱ8ifolUƚqsjH\]ڱcze1tqq6vƵ(郯kE,đβde9{c֜Q9N*۱M%S# Ie%brXXY#Jm5QmIôZp8pކc587ҎD,Y8od餭Uc[^۱=mة\]i)j+֫27y%ʠ&Nczi!jӱ#Q7YUl9o:{W5+KTZǷ?PHvoo/{|_͛xu;5=yj'8(!]#~>St\^y9૟5aX7?_n/ošcQqOWDu\6ܴsѱɱ!˫LJe̜t+uIz//Eqy^.?s>5We}g.{rRPWp~y/>Sueu.jY{],2G ևE\oO8Fi4N********y(>FATATATATATATATATATATATATATAi4N'TATATATATATATATATA8c1} /P4N' :C58i4N********.UAǠ b H58i4N********5AǠ gy\OqQO5_m9S+:EFL9x]7g\FU^#୿kXm?YϾf\;xy3u=x:rXybߙ P4N' P1} b Hq8 b AǠ RT#I*************=jq8iPUPUPUPUPUPUPUPUPUA(>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(>FYؿ?H endstream endobj 17355 0 obj <>stream hjdW!'C y,b-I&wI-a$=]ݽzWZkJs#bijh4J ,C^%(fQ5nWC+Zhkx\ea\m,R +&K)-.bNydZkR&OnJL];R-6G X6V,6kfGX6X6VX6kXͶRXͶưꎵ1bugjd%M- Gت=/cokk;Bnqy԰[6buOO2GlU6j=_U n5=ck]zҰ+7ږvٻ]0RjJM7Aت]f)kĬE6YhVo'fv2fS 8ھ9X6o:>stream h݊__LWU_8`+"b" ,iLg=fz,9A .ZOյgշemzmkpзtQ82%;}+q8J[:ۑrsT[-99[=tJtԷzG6J.ܓu)o6RҞ(5;vhۦ`J:Bє>C;tڼ+Z6ZyK- k^Bl*pl*̥8T{h5y/C}6kKrjڒZݛH=4祆m5}uocu$מl-ks)ePl}V8mZeVCۼڑ gVmnZH/onm͛&:RrQCPXªl-7lmK,&+hLQF%TLMf_5#;K4ٴA/9%\ڦ՟ {P))dUMKi%]=\ҕp\Kz9ʦ ClK|K Twφ´Ք#+le>6f5m ت T8bG럪>h2jcOOebS,>b_Zv-vRnvZU]EVQCC[MZS$U֎*[3և׭j*ܽnUnlrbIs T*y+l彇VݻzC|y>ͻu+)zF cU6>ٽnUUdsQ!b6۪0[63R%2( mBrvwP׻Cekd|*T6em}BlsF d5R%3U) :s6@F5s`[=3JV6 xhE`ۍqGheMx(U_w#E tKr6uO hӾ!C=pGD3 $g$966S, []ێwS.Kxn ]1ykܝX*w%;zG,pZY-$3%$(#N.}sK ~89ʛt^jZ?t>y2>7_}sw7o~o7o^}uoFc_}wnKW7_;1o"o?~zǛ[5z#} }\}u?MS]OG*zw({moFNn5?^۽n'ڿyNJ}v{>pmkL눱ݢ6Vk~ogA<'hr[9a<仴z uq='\_N'r]N|vcE'nf0^5gS/q~0:Φxb{M_վ>6޹heU8>++N.Ex>UdP>lx\ gì ڽ~s*P@U TO*́9c1U T} TFHpR8AU T*P@U T*P@U T*P@U T*P@U T*P$F ' @U T*P@U T*P@/*́9cԱ:wׯo_M9k)5=YMNJciÝA M<ĵq_Ӹt^Y9#3b/y݇q}u6vzl7xi{ඖ.Ƣ}0tϗz\r֘!- DOeRT)U T*P@g7MD8 'xAU T*P>}'UnO-?ܭ*}خIzp][0S?E{ˍ'[^-r^+RqnVt 2<ʀ*P@?B1u T*P8?Dg&xfU T*P% npR8) T*P@U T*P@U T*P@g3:F*P@U T*P@U T*Pkp#IU T*P@U T*P@U T*P@U T*P@U T*P@U T*P@U T*P@U 7F ' @U T*P@U T*P@էG1u T*P=T}ۗgS{yjAbiOgӱxZ{pgPBqm\4.2og{H> K^a\zgMۍ>^^m.h_<3܇5|H L<3@U Tw|DF"e_%U_%*P@U T*P&o~oRT)UjP@U T*P@U T*PG"xf T*P@U T*P@U T*P@B1u T*P@U T*P@U T*܈)N 'U T*P@U T*P@U T*Pk0栎Qu im endstream endobj 17357 0 obj <>stream hmk^}= !0$.PAUD#p +3tPx=Kqoz[h5CJR/Y32,ɬJͬjʛY5>ܯRjAg-Oz詻}daR 3&K)'RL~t*2ͬʵX[j2Gfn!妬d2%5?A)V̜!Ւe RSf*ڶmۺ}R}}m`V1Eˊ6_Q71vVThL!-ɒed!J 9}j6*[5G2GsrkPM57ߪh[JX|uLE8WѦ.s %](;BQwc6e6/I4JDJ^VBիުܷIF^>m#m67vSyc7EiJThBXJ)Vm2kgBUݷ˔ A-;eNX)Ԗo}>u[Wmz$ڛ+H7XGIlu龊6M*oN)74p}Ui[i޷}]%j}Silµ޻N(6fw_}St ]fV}L.~h42S@4Z2KDV}o Ms_EW6LE>3j"5WáUJ5/Ҕ9쾺U&nR&n(>!k5ifӻd:EVo*Z}j9Xo!XXFM],b9F̭VC\q*cvdh"w90ealB/7d/FfHm!T1Pct! U9=}ru[ mqϊC)G_x_TjY뼧'Q/z\G~K8.\'Aų+Osz_PTl=\؅mxN\9-'jU T*P@U T*P AjD,N'T*P@U T*P?G՛n΢xX#Ok]c>x׮t4+5UEs.u4sY#3G\aerֻigs=ujEsT V,ay͘  D"@ 7Ũ5YE@ D[^~ @U T;z[-ŖbKRl)[-Ŗ> T*P@U T*PP#jdq8Y T*P@U T*P@U T*P@/ Uqc1P@U T*P@U T*PP#jdq8Y T*P@U T*P@U T*P@q {=@U T*P@U T*P@jD,N'T*P@U T*P@U T*P@U T*P@U T/Uo>^9rkRUbX?vQe_өsĮW=̹g~q-q}mY~י nu~S ..[=,u5c/[-ŖbK@ @U T*P@U T*P@U T*P@U T*Pߣ 5F' @U T*P@U T*P@@1{ T*P@U T*P@U T*P@֠Fdq8AT㛷n΢xX#Ok]c>x׮t4+5UEs.u4sY#3G\aezsֻigs=ujEsT V,ay͘ L<3@U T*P`1%?ǔ"@2<.U T*P@Bdq*P@U T*P@U T*P@U)cc T*P@U T*P@U TFdq8AU T*P@U T*P@U T/Uo>^9kdjdR#UX?v1+;^|JJekƖz պOp;k9CC[o{z3|x\rZ:HO58β֝׬Kl)[-el 0" endstream endobj 17358 0 obj <>stream h݊_^@LeV,{m̮/^w@+-,os+G5 ]y⋜FY֥QZvmII/K5˶VZRmZleeڗWz:_7}t/%1m2溵p-Kk*ͦ?i5[Kڷ{^T֘|N2T-7.sȊ/s-Ŋ9dE9&2{6ӒӞ%5BhĜk M92l-Blu!&s4mK.B4uV{bW4m߶+D %ǦW9{9"ڸ--|{Uܲ}m"D˶l2KBrJU"E lnQK[MoUYT1"D(גw_"Q˞Z *nږ]to)X w[oK.e۷Iҳ}ٽ5|=|-GiwWzXjUErfߞel_ɪ=UgoȬ5|O{dQ/E_EJ<_H~PEd*dEk>!&xG"3ѣ-R d]E:uJRueV.s[%|wb:mhuhU&]T(6*W{^GRYTQ}ŒnqZ1ʀVK[[.[÷7Q;[m*ʵ85;õZ[ڶ=|/ u1HTP2D^WDt2?oYC0E &],Q׆I%j bDjbԺzbdWW4iW JE;·/ښtwK i([Je%~HCהZn2ZBʩobɨQ-C,-E7eF G DӍ}8jnsJVc4{'5Ї*$"gmMTYrkƲ7nth*wZc-69nFv(Rv\UWy ɅXU٭_oJ+Pɰev5qM5mZ>2᯸)[jḵn=3WE+/n~qwon^pwwoo_wݿY7_ݿo/݇|x~qconGn7燿xwOwxN5,V-xj[]of+|GJcھ^<"zŗ:x״x7XoEy9uܟkWEn}a >6<8vunN?UqzT\Lp=)KUO+þǣ@Y03!1^j=T$^|}s,JQ/'|R*ӎ~]CA&^,\4N2Z7S3=k${@9#yz1=v8n{96.֢xVc,ay֘/"@ę3g&PMBIq*P@U T*P@U T*P@U T*FG)Q"@ D"@ DI߫ѥR|Q#IU T*P@U T9"@ę3g&P@UoQ#j>l@ D(@U T*P@U|Ai4N'U|W8|83qf@U T*P@U T*P@U 5F' @U T*P@U T*P@?*ā8c1U T*P@U T*P@U T*PkP#jרˇ7Ϣgg_ϾdJǴ h. ʡGogL=y'[R9#˜czqܘ1sڹuccysͳ|ɗ3g&Lt)U T*9PӥRt)Ԡ T!A@U T*P@U T*P@U T*~Q#IU T*P@U T*P@?.EKѥ8P*P@U T*P@U T*P@Ul5F' @U T*P@U T*POP8}>FU T*P@U T*P@U T*P@U T*P@U T*P@U T*P@UU58i4NP@U T*P@U T*PNjo_5jSg5)W2X~Kt>T¹@2\gi>stream hj%__$C=!!XĂd$ڻ!I..z9kZ֠[m%ZзŞEsKm4s(ndQJL͢Ǜxs޽o=|sӯ~?=?(%zﮏ9tswVclؖo{?~_d@4Q~^?IZ|>k9~.܃]SG fl{^M!V>"to5VE\ëIe=V'5ϫ||L_|o#|R2WVG{CE[M"ۂw]_;oJ~bW:ץKM;r|?|.~ejp\dyMgς: aݿŋ@,'ߩ;ǡ2EWW#6a;e4q^5*P8>c T*P@U T*P@U T*P@P#j81NT*P@U T*P@U T*ā81| U T*P@U T*P@U T*Pb jD'Ɖq*P@U T*P@U T*P@U T*P@OgP#j81NT*P@U T*P@U T*ā81| U T*P@U T*P@U T*Pb jD'Ɖq*P@UèϢ!xX#k^,NJiv%WS砉Mq\_˸tރK,͜tG]az{֫icǗqc5:\]n8Ʋ֜K3L T*Pf>c T*P@U T*P@U T*P@k381NP[t.KR دn?5{S*=Z%C!~D\/a{r`!Dvbz>AE#QkGs~잱sܷƳY/r]<4 Ԁy*qȌcU TI}tY#|X#_$㚬˱b?xөsc8/\fi漿g~X/c[{z1m2x\p[[s_\]n8Z/K(Ԉy 'xP@U T*P@U T*P_M!| 1P@U T*P@U T*PP#j81NT*P@U T*P@U T*P@51| T*P@U T*P@U TԈ1NU T*P@U T*P@U T*Pb 1| U T*P@QOm z endstream endobj 17360 0 obj <>stream hjd_1 $!rr"nKF yt0$`gsܻW׮G{Y8VKo^T4shn)OR[X\G(mEo[҇늆ˮ[umk-o=v׍:bfq.-kaVث+4uէڶTkk܆k59Ӧp ӦZi8l IZϮ-&ZeVfLUٻky!Gj6MsySfڜMUaўںnMa[ ^\ljM/*z-J1(ӵ6Lmv'-8\;W8V[sȦFݴ5m( {smwUlUV͡*[յ۴j3մ2Ec)۬ŴMN Kŵe+1ygvmk׭];aUJɴj)s|{ܴɴ]ZZK^7ռ]l}zݺ\l3zݴqe6&RC0n2f쪶MUkur,Vk0?jZJh 6m"uX6_SLeS?u4O3yizx Ua` %'iPkqt\\yDq.W)u;l1hw\) )UQS\P#y,osFny{H^m>]oyvI5Qt^xQ8ܑڪڝXwFv ^ycK-4̲sMۃQ6O˫FiI\_|qۯ>~}?On;CIo~}ǛӏODzWyO׏W~NV.=_N=}Wuuf=_߱%i >eٵX[ϋ _5c ?V8n7>Hvף<=KRaOPGn-ܹ:Γ0eN= >5Gkk1|_߾?6G9W戩; \&ml_‹FU_r=sQJFrqU+x)ײg]v2lFU T*P@U T*P@U T*Pa nč4N'T*P@U T*P@U T́9c1U T*P@U T*P@U T*Pkp#nє#|_r?G(d؎{PJN{o%6bOkpc}I[o0moGƎ/טծZt.BwY걏esXk^g.i ;xAU T*P@U TAc T*P@U T*P@U T*P@?IU T*P@U T*P@U`}>FU T*P@U T*P@U78i4NP@U T*P@U T*P@U T*Pq߽x9rkS7Ӟ۱boA=pmFLqc .}sU:_\.K=lk%- Ds<U T*P@U T_"0栏FoTF"g T*P@U T*P@U(7F' @U T*P@U T*P 栏c1P@U T*P@U T*P@UF 7{tts4#צoʧ=Y/cT{l~m\fyXߣGǖ[9}[9Ǵ˸>}5jt=]zc֚KZg➉.şw T*P@ύ 0(< endstream endobj 17361 0 obj <>stream hj%_^`P]n` q! &? ƒdB>ku:0\gh9kW^F50l͂R҇FHc͐˔l1YE):E9l)7Jpjɮ:K\COu#\gR 3iQ 6ӥRi(ՕOn]ۂ]ŔV)}vʹ9*ӴY)j-SKôYZ/U^kZeVfʮUٻky$jg30L[r95ӖGnR][C~ Z]CYp(kY!Ʀ67n4l#n6tfu-U9b[ % =vWM[_UYl^CQM[uK-^7l6ruS76 =P1nMfLnMV}sfi~qm ׭xPؼn*gZV)h%zB&@vkޫkPƬU٢kg1mqDӎj*^NO1Jz)t51h5 xPe*[ô:U 6TiճէPf*c=lꆎXk9lHK5v@u u-LU¬P'x][6q54UBekj Zth5F+(Um0TvXnbR [vm ]'ҵ։}U,p~΢f֨2E?vauXuzιkaյv:Uణ(Yݪ!)6[9duVE]k`ŵF]ۜz=yԵ?BnּnbfYP)TnFީ,lFuOL?6 l:bS *2Lmi/ra:hGX|ٕv*.Y^*5X]fΞ b 6k':s*P@0栏c T*P@U T*P@U TFHq8AU T*P@U T*P@U T*P@U T*P@U T*P@U T*P@U TIq*P@U T*P@U T*PF1} T*P@U T*P@U T*P@kp#nq8i T*P@U T*P@U?>F_=^xG#)+4yq>Zv\k[rws?:g97Xcz%~_&Cjzuwv2Ο!j6xG`<[oYu}KwxUW%P@U T*P@U T*P@šWOnM9'5bޫq'vurPvw:uvq9_x=ڡY9|{^طz>9c1V|-:=]zcw{w&ޙxgU T*P@U T*P@U T*P@UIq*P@U T*P@U T*P90}>FU T*P@U T*P@U T*P܈i4N'U T*P@U T*P@Usc1P@U T*P@U T*P@U?Iq*P@U T*P~"T)G$F,/M9^%ֈ=Y/c~TөĖ6.2kpc}![9}[9cy\>smעsqރ e>ay1Dw&ޙxgU T*P@U Tcp#nq8i T*P@U T*P@U T*P@U T*P@U Tp#IU T*P@U T*P@UC1} T*P@U T*P@U T*P@kp#nq8iꗅ 0S endstream endobj 17362 0 obj <>stream h[kJ>"! ސ e-b-I&筚O&6yXSy]SgB ZM^T4C[B.Kcȫ$R(m6r)wJjh%6{ޒFn1V.)ъVӥR ^]Y׼\|۶GH.0%UeiJ]!RM9Mݦ֊iiGq<\lc&ۃNmmYVU(29fZ0L[r96Ӗ-VY]l+{Tpm%VoPPg({ wM/Zش:J)Th[+ Uy'yZS8kMwRU\ģyߚ6ME.V6+kyߺʟ֛}Sj.79d}+޷!̢}>nh56M5cF*,޷lsy߆ɳbPCZn * [crW=n u34ӵC̮:\lUZ(T!WZlcU^6[c)nkm (5i]d>tCЍ1k B~7k U@  3Z!UzAaShVPUb۵6d mFO6iZI2YiZUikBla :YqmpV*+}C,:0Voɾ澡. ]E*ZeD6sw]l6*Zf GRlfaW\3mZ۵dV+V]J%gVVk:,YcUz9Yc%sX"~5w5nĊ9v(7dKVZ7dҼDUM,Y M,Q2TS*[7aE%k,XDpӪK5HMXqM4N/{(<%Kxzk3zh*M?l5btΆ%ŖWe ;ScX.^&xeyt.I=蒒λhqw2}N7̴[;FIj[fG3lIM#(ey5PL,}Y8j`ٗSӫ\?|~t?]7wv_cۇǧ~{ҕn?tlׇb~ӿ~z;rw5o}z0zӷ 64n7Z=,Ik9={{*~o}=U] _-UE KӼl޳$YoPx=ۛ\Wu牗{vE=a_lQsh2>h|8 7mEWQwA?{S%*G_xގxݴ+zϏgS?ܵqd&gCR3_WlgGiywe^_%eB6߸T*P@U T*P s`s9@U T*P@U T*P@U TPq#U T*P@U T*P@U s`s9@U T*P@U T*P@U T܈ N'U T*P@U T*P@Us0ǘc1P@U T*P@U T*P@U T*P@U T*P@U T*P@U T*PPq#U T*P@U T䋧nߟM9G5cymAbXړM9vO8(;:M~q܃ٞ9|^#ae]g_N/nu~݋ѽm<ֲ=3;fi 3~e0`1ǘc T*P@U T*P@U T*P@_dp*P@U T*P@Uo ?g&P@U T*P@U T*P@U T*P@U T*P~1TFdp28AU T*P@U T*P@9c*P@U T*P@U T*P@U|7F' @U T*P@U T*P@1s T*P@U T*P@U T*P@5728 NP@U T*P@U T/}6%֌)5ciO7ر_>stream hjeEWⅇAEt " h"ID|{:pA3lɮUW=j!9V&[~ inrY 1JU ljV%އjh%{\ mv롷q#X<تl*Ve}zi5b^b Elu*{t%O/nu[:h[+Z5ncixuS2׭)h^l+^7rYMn]{ئL^^iC릎E%Բy Quet֢S_ oJ1m(^7lsy݆CrMi*21[*^C˱X,Z6x2\-Ɯ:쨧䭡MϬEGRxkۘ(/eS=VVToklO5=1Arh9=Imzša)+ٰerY%Bzcy=~h_XCs1s Ѝt#******u  J endstream endobj 17364 0 obj <>stream hjd_开"N ${B.B.d$Ϫ곥#g+8ջZ+ 9۶o6gZM-%ȶ4Jhn9}߷\fyV̾nCl=*[7 Cl;:Mqj3{D &WDun-zh6,KhE-u%sխ_#[C-rm \hOIjh͒VJhmZArwv̤MĵznZp'mC[ZZڡRhmV%{MXɧ7udDF L'} B+ԥ}-}EĒY=ԏG߼yUn#ʦZL~WkZ-)\}^AyܢurlSxDyOc|&K#T'OWq1ByG^){yuC*9^ +lӹ2I|ueĆagluOG&ee3O Әm}z^gO;8(~z^q5O~wxջo|zwKE櫫/n>aKW<A?^9OÏ7"ݭּ|<^ǿknk0/jjdDZq{~5:*ì~ﯯ!8_- 2΋\}]'fʯ(Px^7^ؓUg<~Gfq쳟m1xe!pDZkVѾɾ!ǍEEr=K]wlJ?J,kSe{iO7۱8xA99hⷸ6.2{73=O=C 5ر}Kz5}nx\p[{ѹxރ7c-a:c~I˔bJ1RB @U T*P@U T*P@Q/*?/*`Y+Y endstream endobj 17365 0 obj <>stream h͎_/L70 qJVEc$#眺ÖoAu+.ĕWҶ[orIʶju%Qou/Q\[%tmiN)M(X镚ZRںt94e뵇VFJoS[hmڠKU8Ք]VLmn5{ 62.ڱՒۧ^B6|eZn:Sm([#6cϵ.u֨$QlGdrM4nZKMnڈβ5-ghJi:WB۽nZV5ù֢nv{Mi6jM)OGݴQ7퓶rMhkվN%BC-M{͡]'R+\[B:UH5H3H)U>GhmZeItuwVĒVĒ&JI9O#}oV(hYC+jBQU4u+Zƌ*bhuNZeiVDvpV檡UUghɔ]2]7Qb' VĒ*f3{uoU%>vnSe lk+ZdWd٘sfXBl+ETzZ4Q7<Z7uJ`G*{[̨]kMK;'"fuBe3&,~-6q0I"99Q:m 7xxFU7(fET,G]QἽF CCG=8w(p^m)_(LG%5)9~Rjo)QKEksŪڡwʅ(/Lɹ]6tvis藭w\rqlyg-n}v޾yuݻ盇oۿ^߿^Izwo|Ww{ãxTCSotwW<>NGܿ~ûicl7{湜g/ӳFe^7\Mqbc|j5q=f}O<9q\?msAb~џx@P@U T*P@U T*P>ETaA@U T*P@U T*P@U T*>Iq*P@U T*P@U T*>>F/oˇ7ǾǬhQ{i9?E[n<O[۵URnT4s:;,JŘQt6Ӆse=p.1S[=V]'qͿ^'چ=N;z^:~=W%^@U T*P@U T*P@U T*P@ FHq*P@U T*P@U T*P7Ș>F@U T*P@U T*P@U T*>4N'T*P@U T*P@U T*>1}>@U T*P@U T*P@U Ta nq8i T*P@U T*P@U Ta 栏c1P@U T*P@U T*P@Ukp#IU T*P@U T*P@U T*P@U T*P@U T*P@U T*P@3/܈i4N'U T*P@U T*P@ s`}>@U T*P@U T*P@U Ta nč4N'T*P@U T*P@U Ta 1} T*P@U T*P@U T*܈i4N'U T*P@U T*P@U T}z͵ ()oȿaYO~gYbɎ}"ܯaUe2.8is9#1^^2^|>stream hˎW7_A _ C- YH 'Nw3Z^?VgwTTeD}1٧r:4zJMv*XTQX9JJjcXKjϹbhq#=kf8nvZ8]GĕzĕJ֟X6-gwd׹ӎsTRq.gYt5mnǞTz[{Gζ"*+bl.*%A^:vrvt6/돖:L{Dl-k5mMq۵;vhcgwǮTGJͱ6k sX;\]܎US]0V={9vK*4%s;2o9IUvմMX]JkuGhm4-6znchcm6My<ͱʶ6mWm*^6yTs\Vu]Y\9Tr&uSǪ4ձ[͓oZ.MEnK}?붢릍S붔x9\lnKpI#MynQ붫u-:\Yq5rvuS׌~cwcTYf*[ĉ[FKQGUSc,oqk<ߤ,ufL5eeISm2bYQ!BZű]^ء媎U6±6Ouh-md'&"V.>,O[U bӈ_t͗"wyƊ;G޽\yOݎg8u_Qb߁OыzEc{nWsnjmԁnisǯ "ʫJ\ygwMO"ꉼ'f쳇߼~7^=^=ͷo{zwR_<{߿~Coߥ7#soëw?=<阏k9o;h5giӤzY$VuU<|đ>stream h݊$_%`?2A+i//` XbvDTl^Y7÷KoGw8,CGi=KME+kӣjے͜SݭxTRV=:=ji4Z Hc4G %#t+p]i:`L[j*Y=l m ZwHG,;3whVzh6Whw*u֬p-jeڪlZkMBejU6[W]{l;*u*l:kuVSy5:μЎ8~_Q{TGޡ] 3ʦ\Q,]P/ve[9ՕbuUNʶv{[j:.QwjNnZmE:h gmFu+siAhnClʁ mըnڮ!ݣn-NY1+ڡP6p^(\IΈ̝tQm*-"k͍3M,*EMyjUu)>H :Ph#sYêh1h%UWݡf>IehW*I5h'-DYCdbu)@UXF;v%3+ x!*یv2}cU6v2D\+XnmfʣzL4^7Kt LzЎd5ɴhN&Xv2z%֣L,QZa%6L,1v2,th'%MTrRɴU*v2DNϡih'S\=TգLFSᎺIf鴖+,v*,8]Clj\Khu"xhUKh&ܵC^:|}zwh}j9v\mvC+͵~kD|DݼӶEݦOܢpSC#Jm/jUlQ<֢z"m+#꧳,Y(wqBbaܗnW 0hwyeQF"z=E6D%էE_4Vks#6|Ɗ}~u|Xd3 *UB+J=\=YTu{^>W~yዷO<~wOwo~o|T_?o7!?ܽyMo{>$ǔHo*ADR__9>ڗ؎z.XI͵UG,P6ޔؓ~|jSAuE|߼-6 gs5ڧ1?C_=7:~U. :ҏλU刏v֕^/8z=w'Lv>ߞًnp]3[/\^ϗ{:]QUk!ao>, f)nU T*PQ90s9U T*P@U T*P@U 7F' @U T*P@U T*P@U T́9c1U T*P@U T*P@U728 NP@U T*P@U T*P@<728| sSs9@U T*P@U T*P@čdp*P@U T*P@U T*P@OB/~busak)e2J8 v I/Guvkv$Exx3g8Wv9tC;&ke~Wu^0OMb1C!~dU T*P@U T*P@U TUs0ǘc1P@U T*P@U T*Pp#ndp28 T*P@U T*P@U T*P@_9c*P@U T*P@U T*Pq#U T*P7F' @U T*P@U T*P@U T*P}4ndp28 T*P@U T*P@U T,9c*P@U T*P@U T*P@U|7F' @U T*P@U T*Pb 1s T*P@U T*P@U T*P@5728 NP@U T*P@U T*Pk0s9c*P@U T*P@U T*P@U|7s#F endstream endobj 17368 0 obj <>stream h]k$JE]`|$${C./kH2!>95X)'Ty9^fQ6RjA[U*Rh,1 zX8jQXRŢ5VҒ[w]^J+Kuueu][\חV׍j5,}nIa+̚k֝ O۵ut4ZLZkd+Q85laZv-%6*[]iՖ\l-6CT6kjӍ6ZeU(6 PfVӦzqumQ=s-ڮ6l5jմll6+شY)zͮMVZe;G]RõmIkےVާm>PJ2m6-Q–\PSѵVۢ([ l1iL+Sځ4jV91FCskltkh3֨m)5jW4Uc954֭p]rnlUFPjUkZeVFhUQnRr)nнnrVVM㢺{zRXkyݴ%*Ün-[ M/5z>lCZCttliMZyS:mBHuK1W0:\O¨p.RsiƋյEakUV*[յJpVϴd ]Zf!4ŵYLfOٵuiBk-\ڱ5NeSMDFފF]l-HkԵ/Mxh*[+Tk: Qx,@z (5&dUf-0VE7ھPUld}&jP*osɵC%*Xr|',V'P "ֲK4jZ;JZIrmvְ`V_K=̴NM"p[h[2mpqxx<>Av}y5V}LyyCcUN@Ьѕb;6W輭m>Q՘^R\j"Ւ\o-VcS[#C,V޵bPu3ȰusȰmȰ}ȰLWW\?~p|ۧ?㻇>\﮾{|z͏׏zeGIVzWq/{ϷWß4birO^R@ko|}g9|e9ޮjv`ײ6 nG ضx^׾Mؾ$pK8'b $9?TFP@U T*P@U T*P@U T*P@U T*P@U78i4NP@U T*P@U T*PUsc1P@2T{|h$VܔUb?r3zmNN[<8tog=z${omlsǴחq}s Y:_i.tX6y%- D<33U T*P@UFHq8AU T*P@U T*P@U4N'T*P@U T*P@U T_Usc nč4N'T*P@U T*P@US܈i4N'U T*P@U T*P@>F@U T*P@U T*P@U T*~Xq[n|є=?{H=Y.cTA=pmFL?qc .}3=s#cKmκ62q{9[,ER},\@U T*P@U T*P@U T܈i4NP@U T*P@U T*Pa 栏c_޽tws4eotn*zȟd؎S6EwSg-q\md:73==B~ksV9c˸>}9,ER},\Y2=c=dM:2;©y"^NtrHƲΊhw鞱c̳_g%gخ 9oO>|kAU T*P@U T/ s`}>@U T*P@U T*P@U Tk܈i4N'U T*P@ %ֱ-U endstream endobj 17369 0 obj <>stream hݎG__ME"@$$@(1qaɱ#Y{3=;_SUW}/\kZoUk-%Tknie-o˫$oټrf꘡[+9mkk"ЎmڹBYkӾ͵V]T]wPNzͧzuzMzMz>o]6֊}pQB/++J9zv/-ﳹ^KSK/yyo/E*-5BKQkk>2Wܞ#u*ժ3Wŝ=*]eq~=Ug / ]zei>}ά β\!mv ={ojmϩm-]zXi^12CkmFB?ԞO.yw^3Ihe:zďL-xVq-*(%+^Oۊ!W}zjhSrPF{x'GR=wbsgTf=DW׫Ѧ%Wz{ Wܹ{F++ʞz]S\*׋WS }U{7AmVAjȝإ܉Bȝv-ȓpXmβ^qW\mP~#PfWXF~b_jV͑_ZЫ؛IYhRLlB#jζf*kLu䷗>@-O"aN{ ?|݋_?~wyWo.8zˇw?ۗtg7%{y*}w/poAK]=^}_l]kؔpFEzhjr F&ٽD?zZƣng|.5Hqї"ޙxg T*P@U TaAQ@U T*P@U T*P@U T*FHpR8AU T~_}%ySK#s{|߹~Vmjx~[SEvγdzyFۓ-gs|>stream h͎$W[@}$ ^B i5""1f.jTVd'"(i9ݏtdcyd;luնQВQSk>GM>G+b[~5(;YV:*K0ckzc鱹:[7e |Ygչ#^j_oK>ryy|ѼZN+r񊜻D]}FݥsF6tk>Zx]AoJKߏRq?ғgԥly_ImwjӼ+GZ6G5,{jFY'mju6^GghZRQvj9kY,hzv<#[Et;x;ϒGk kvw53T) CY3 6535jluGkgh孭3:3jfjޑǫ8kFY3 =kXfigftj鬙uUfvP빭Dڸk|z[Y3z{;58kF5 /f*]Om9x;sx;xͻjxͻvxͻێxᜒʫI׮y~jVݝWwG!ˌیx;?#+֬_y* kȯtWkȯ.;E:vn_UVxy+WnWWۭF~:PW#JiW; l_ٵvkD~_e+wS)2. . MZYH4[px+~xۏ;TS{im:sw՚k)"][eWkY5w߾leMcvzϯ랮ߋks}wݥ{m|_{r};_׻=Wo/빮cxBw‚wmBWy[/j%ϟWcjqOD1E`6("mQ*VvlVVxk ޓv{}fJo3\Tܜ{U/0T&\W7e/+9 Ď̵!~zO)*******1UT#Hq8 (>FATATATATATATATATATATAT5T#Hq8 (>FATATATATATATA'Uo^dqx]~"Kynvn&=WUٻ]˲{eMW~[y+i}n[}| ?e)UP_P4N' hjq8iPUPUPUPUPUPUPUPUPUPUPUPU4H58i4N*********⠏cPUPUPUPUPUPUPUPUPUPUPUa H58i4N*********⠏cPUPUPUPUPUPUPUPUPUPUPUa H58i4N*********⠏cPUPUPUPUPUPUPUPUPUPUPUa H58i4N********k(>FATATATATATATATATATATATATATATATATATATATATA*jq8iPUPUPUPUPUPUPUPUPUPUPUPUPGS4N' g8cS0l endstream endobj 17371 0 obj <>stream h݊$[0? t`m` Xbw#tvwTeVFHSHG8z>Gzۆȳm-}Wa9Z.ÇhsEl;z-ۏgĎc}8gĮc|Ut=6cᱹoz'6~!}!YXsx]a˗mj)]e*"Uj_cwwo׼s׼/,uмE~;VF~G^~~\uUfP"ci<"ʦ1^D~U-3Rwj1":>jxͻZwjޝuX"~=dwGSzZu=]j}ͻ4ȑ_UW+򫻯KߚwȯfT#[FK SU#;J]e|jh^Jrķc"kjěTuF杩F}F]kwXUMoWBoWgqG|w #~"2RoG>xUTxnە9sx;a\js+9pVX+ K[x];έq4#9DZdOWuFkޑ.^cx-YZ$W2VZRkWeW;S#~;xaVtykZR܊.vkQKʠ:Pn+jI^mkk^Mk٢T[ҽFԒZ˫ Yg^zG#R -^Hjw1z"q)r&?fZ#+jѢfy]}ZmtGR}ZAӋmn)%H5;@_GZ1ZA-ܚ.~#oyHNd vRݯ?|ݫ_߼y7NEǾ/w;;ˇ=B^ͣ >}_@-VsOHq:gkڞ;Ҧޮۓ&$k1g6I9 T=\^5Mn\+>({辋'Ŝx{}^_?gG=Qq2?]qniעmmC煎!FY2 Jy,(FTUU/+JmU^{~?k9z{^";o칠n :>C1YzUPUP@58i4N************GST#I********_UAǠ a H58i4N********5AǠ a H58i4N**)U?_J?)J\kk؎k7T:]SƵk/nsnmEְmǚs5yvίE{up]uC@D|g;ߙ AǠ P4N' yQT#I********_:UAǠ a H58i4N******T[^Rl endstream endobj 17372 0 obj <>stream h݊$_^@L_e&e[`BbՎ]a>Q9S]_?AOGW8E/f-؎V=[JlR/se-ϒG/=KgWޙrwG赵{IhyZr}[*Ki>Jc˵-}~(5ʫת1Z(kFXygc$VC߷"~(nGVrήWuJTjr}ˊgs}+[Qqhi+~6zGv4]/1Te^{[%|xЏj>cnU^Ncr^wk{US^y{oWޑgwzv,[SuNc[*Q_9]*ܢέJckw3;&E}\qD}5Z%n}D}W޹G}#kxs }W<z}U~۵joS׷kWjDozՁ jѡWJW6tNOwtzFlgP\#M(t(>~wQH#ū^޲{ R]=ʫZD*j^yGnWgWx9\/^ 'i)9+-#w8[x5ūQZhGGbSZy}J G0eF.%l ; 4(n|0YCSwY_*qJG'xƾ U7ϥҢ0v LF-O[RQz3sRsgI'ܟ1E ?m2[>ww_=}w?ܾ7xu۷=;7_?{otcw?x4޹K7??y+^m~}/}j>k -.Yhm.jh͈OYޛ|et~}}n2㟣Z>kZxk*xfc^h2|ˮٽJ{~ݓu;_8S{<5m^ynhߤ"ᚈ-8Sϳ~ʊ&j/8Ǽh_t츶cJӍɕ~yl8c^_sF}vvbZ?foϰs;ٻU$t f7~ƳU\z9ќhN4'G*P@U T*P@U T*P@U T*Panč4N'T*P@U T*P@U TQ90}>FU T*P@U T*P@U T*Pa nč4N'T*P@U T*P@U T́9c1U T*P@U T*P@U T*Pkp#nq8i T*P@U T*P@UU'=2#{yʊ}Zz%;glV~*tH~.ϼ6qz-wNϱטNˇyi>}ȁqesXk^g^ҥRt)_AU T*P@U T*P@UFHq8AU T*P@U T*P@?g3l.EKѥB @U T*P@U T*Pq#IUƉi4N'U T*P@U T*P@UuTaA@U T*P@U T*P@U T*~Xq#IU T*P@U T*P@Us`}q#IU T*P@U TFHq8AU T*P@U T*P@9%X4a? endstream endobj 17373 0 obj <>stream h݊E__@L IB./ydƄ}v5@..Z]:UuvӃG8%Z1j#ܬ9璎4sf(uzŝ-^K0}چmlZbͰ^=%g[w}QZrr}U{4׷#\ߏTCsPG+nKEq^m^3Mʽ(h;pQ\ߎp}?r C]?Hɩw+b-C5Dp]|n#">CtNĚ^.c2yoS9=M6ۊ=jkw緍Z{DϯFXJOWK߮͞XuFk5J߮=amͷ*2T{A2Ks:WsxIXEx˳IX PhO\f?x5{kmֱ'_501O}Eۃ^$<='3g ז~t.WIrx?oqlʓ{ kkaׅl7T*P@U T*P@U T*P@U7R8)NP@U T*P@U T*Pzë7wY)#'nT5uK2tY%K{m/\7s]7 ۾<1Cm}wƬ1}>m.<=8Zcs{eRRT)/Ԡ T*P@U T*P@U T*Pg37R8)NP@U T*P@U T*P0栎QǨc T*P@U T*P@U T*P@FHpR8AU T*P@U T*P@`AQ@U T*P@U T*P@U TQT՛WSYbr|X#{>[ݶ|ӨsdMqoܥ˸tsl\{H [38c\}Ͼwn;u65x{qư:JQRT)^AU T*P@U T*P@U0u:FU T*P@U T*P@UW*܈)N 'U T*P@U T*P@U T*PŇ5:FQ@U T*P@U T*P@FHpR8AU T*P@U T*P@U T*>1u:@U T*P@U T*P7F ' @U T*P@U T*P@U Ta 栎QǨc1P@U T*P@U T*PŇ57FkqƁ*P@U T*P@U T*P@U T*?7F ' @U T*P@U T*PQ90u:FU T*P@U T*P@կU/;$iI&E𸨏 \{Z #ߞ,Y;yދ]ݶz%+~ˡK) endstream endobj 17374 0 obj <>stream h݊__LWu1`HBrar1x@4&]3=-\ :}v׮%9oIm+{KH[j={snM_Ѻ7vԜyleoٛY}-[5bVgضR#o=;JmǦ}xezlAC6#Uv\m=u#5ãsK%wϊ,x_Մz6#GEed{x՗zZZ=ʘ>=^TkF9DZJɒFWm߷\7krhm zνZ<0Cע3W9BYKp=Ԯ!nۑs[w{ȫ8#9 }p)UjUvW6CߪWޑBߦcRRy \=mC_ͮ׶%E|W{mlh)VZ1)*cGMV}v{+EC_͢굌v坥Gܪ6K٪zVƖsM3wh)['V5jw<~*C`9 >k+(,&G|W{"TK5vjwFbHjOW(UvZM9ڽo+o;R+o-╷;Rxik/^9w6G>SkW뛤ByFB<ۺ6C<;՞%y/ͽ^eK}\Z[[G+Ί$^Yr Gn%CyvHýīK`v24A~vwV$ju:+0Zu/%n$^icWYsķmD|W{x5em=$=%02,g2UK╕^%tFX>jEjgM-ǫ7Y)TCfuP%(a¶_UCbjZhl#Va -.\‘ Cg>FWJ>z|G(jcDWٴFTd;(>4Wr|sfF/|G*qRfjnc@kqH1DI MЇGyo~{won~͟^wݿ Yڷow߾ҍ?>{o Âx{ƌrOxw7t^/<{÷R◵2euGg gFw{?sY'yT]*ǡ>zg\gNqgZ~YggϭlƷ|+}i_UW?}ݿ~ۿ|sDn*$P?~^3U=U@)WO1RWK {,g[ _.EGٻyYa]>ֺ?x߯9bʎ8u=nm&tʣ~ʹv91ُ7`ee}m9;\+}xu!=*moܘ?#=w7cO-Chu]MTg_kjGuڌw2v|qh cҏ]qyv9_E&eL\WìZįzNT*P@U T*P@U T*P@U T*P@U T*P@UTFHpR8AU T*P@U T*P@:F*P@U T*P@U T*P@U7F ' @U T*P@U T*P@1u T*P@U T*P@U T*P@57R8)NP@U T*P@U T*P0栎QǨc T*P@U T*P@U T*P@?Ip*P@U T*P@U T*P@U T*P@U T*P@U T*PnčN 'T*P@U T*P@U TQ90u:FU T U}pՔc$~<7(^~ٓro<NIڸqK,\z$_{/0eoƘ}Z_smIsѾx\q/g_65R, D83qfU T*P@U T܈)N 'U T*P@U T*P@g3:FQ@U T*P@U T*P@U T*~Xq#IU T*P@U T*P@UsPǨc1U T*P@U T* (npR8) T*Pſbu:@U T*P@U T*P@Y7F ' @U T*P@U T*P@U TAQN7~WSܔ{eO˱ھW8(;:'MlkZZE/} endstream endobj 17375 0 obj <>stream h]\fwE> $[!! d5!>oU^,'@l̼fv5yv}?Z=}4چ8G>\G.ˤ9#rC Y?뜮Zq}VܞQB_mGRC/lϊz]c^[g5]-Nח|(R4)UeQV#e6=c=ߗ*èr*ͯVIWkvTWQ3b)ry%tzPQz2Ma"Ӵ.2M[ae3(e1}f +i\#mpNGMgx$EUFqv+kx%W{xIά5wgx:C=õ^G/ӎUx+%eUW /!uK];qh%\~iܽT|׏S#CqG D":Q_3mQ_fwCPڥ~ :]f84{wCUj6ʼ%dR^U5-;ϵH*Q_TF}5NNа4z}h:tC };F={#ί!z1'q+NNw8ks 3q~ՙ 8hONpV4/2r(WlxCW~W{woٟ[DsΖ'g%EUG?\2xKPvfX2ŁUWLxU몥Cu7k_Q_q`uW ⎖C3E}5"JcXq׊{Sj:zhI).SΦ"ٱH®⦚b+0Tԗ|6ͳz;؂}k,2gk,~JrOkJnx_ p{t1-, _k,:"负-뽶_p5|$e%߼~{?7߽|ǯ~_c_}㯿y8ܿ{7o%9]򻗗b~?{>x^x.=~_u_EV?=f}Wľkvsyn_ۏf{yv6ong:d1x[p{͂ԛk­Y,;/ͮ8)bz7wq{|-}o#9̡qwi;idېОkT]9/P ~E1,vF~;vn]{]?Z|͞s^mɮ=ٯ=؋f]Oy&}ktǬ^?}FP@U T*P@nč4N'T*P@U T*P@U T*́9c1U T*P@U T*P@U T*Pkp#nq8i T*P@U T*P@U TaA@UnǗ>5L??g*r~Tܓv챷+ݝfKm{wsl#ƿ-ɷk9kh}N|?xͽܭvעstK=,}&- DF*P@U T*P@U T*P@U|7F' @U T*P@U T*Pb 栏c1P@U T*P@U T*P@U/FHq8AU T*P@U T*P@_1}>@U T*P@U T*P@U T*P@;Iq*P@U T*P@U T*P@U T*P@UHq8A_/_~֔3$f*r~X3d{{O ewS碉-q\mdsl#ƿZ>Z{>9^s97v|-:O{Lrkgn"@ D"@ Y_ D]u*P@U Tٟ"@ @_FIU T*P@U T*P@Ug*́9c1?DտGM endstream endobj 17376 0 obj <>stream h݊__LuUCHBrrXC< KF ywי0wst]U{շ{ϾYl[5ǶczsnL)m%7QC o#Vں47Q9>rh6ԅ5ʹv߷ٺk).u&uODZm-^,uW3>1gmp}V\ 'R2B/e9;j\|Yqg&?I\_---Ccee$MZC߷\g(C~^qfیۏ꡸ceJ9z蛼Q#ʞz=%ze2S9kފZn.GZ|Y*VO{5X;4k+J#MqjrqJƩE,<ԛ|Z돈E,Q9H1楻.}4ǣQi|rbm ^B+9;(ޞ[M{vfWSժ ՞څUɵ-U}B߷jzU\/wU-5 Y/~*nڊ; )n [5RoϭbT!nֽ՞*L2nC T{~W6=UҴRW6tfd 6Kuxjj =Wj$]w3aq-^kݏնO>VTj>V㼾UoYkkiy]u;k\S; Vxg?v^.q@ק]0q͞]ma@lپA\r;%o_|ݘ?F1#73f2n]/ίi6]ǰ Iv>ϬX+mW\]x>UjhRvQs_ k_cP@U T*P@U T1p#npR8) T*P@U T*P@U TaAQ@U T*P@U T*P@U T*~Xq#IU T*P@U T*P@U s`u:@U T*P@U T*P@U T*P@U T*P?݇rOk)dziO'˱ھpPvw:uN5ZEkfy߫GſWҟqm \kYާ?c<^}.\/nkD4ư"@3L<3*P@U{ǿw{ 7Fy T*P@U T*P@U T*́9c1U T*P@U T*P@U T*Pkp#npR8) T*P@U T*P@U TaAQ@U T*P@U T*P@U T*~Xq#IU T*P@U T*P@U s`u:@U T*P@U T*P@U T܈)N 'U T*P@U T*P@UsPǨc1P@٨ջ{S.{Ic9 O2ScAXqv-{!v?nK[^z{`ugcLmMde՟qn83ǗBPSOEw9xdQǨc T*P@U T*P@UߢFHpR8AU T*P@U}~<+yOrqZkws׫ݶ>=mdK{{Ҿ'?7{}_\ f7ƣUkOO8Q(N'AU T*P@U T*P1u:F*P@U T*P@U T*~q#IU T*P@U T*P@U T*Pa 栎QǨc1P l* endstream endobj 17377 0 obj <>stream hn$E[;p+3%Ă A,a ld!/"<=,8,A/̪zK{~GS?u؆+շwm[sjw>+‡-{EHG^ˇZ;Ӭ+bWFNO-9\<鱥k#ymGz{.G*vcc]`+w]tV;S{}o%1Wֺ*.Wuc7ב1xݱxȯ׺{E~'I̘i<#z6QV%NeV3+ǂJ.FIetX#^Ε#^AWڡT5WW%jE׈8"~[xye+r*1;9}Wc׺ZwZwWvtxG-zW_o=S_ժVu6i"~hf{~3ƮZWzf6<^w~Ue.ZGW^-1Zwȯs?ȯ^E6iuE~5n=;v<^~D~CCծPxŒx7}?JRD~ו3E~UnoOJG$ZEqư?Vn`9ؑd{sdl%,NJ<[fhh+]6sl*8v0g$~[c;X;mMAWS>Hߪ<#@irT_w:"ގ,HȻ+w$?\_nKe94~Y# PMwOo^|o_>>{uL /o>{|z׏9>y1g QW~/7}僇4m>}o~x[}(0H6i KrX+ė5;fϿ- 6^g ^~|]Tr8{y]?|h޶~ΗΫy}}O|zs~R_ye;оް=$}w<7b\v7~i6;d☝w.|GğOMq@TATATATATA*jq8iPUPUPUPUPUPUPUPUPUPUPU'(>FATATATATATATATATATQT#I***********5AǠ FIqBTATATATATATATATATATyFIqBji4N'TATATATATATATATATAAqc1***********XC5R4N' 8c1TATAgIqBTATATATATA:ji4N'TATATATATATATATAT ⠏cPUPUPUPUPUPUPUPUPUPUPU|ji4N'TATATATATATATATAT>FǠ b H58i4N********5}>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(}>F***************U0'u endstream endobj 17378 0 obj <>stream h݊oen@gNb0$!99P,/ȒdB>oUM;Dsl9oϺm׹mnum3Ƕܜۑc}uT7Gs3o-67Vg߶vL7c߹!!}5BǶ=bYv?ۚp=(y_3̭TrrC=Qz5!ϖ GcZ|4_qg/>~-đYkfvKw|lDZgYv_|=Z(%x4CvK>MWfk$S?$ܻQJ+G+%ۖS߷Cv ${Dz1UFrIߚeo-*,r+#e9k*MqGje,_)'mqV=۪jK]s+ejo׎9l"]q[vGW.G~J<_qnjvŕsj#Zɚl/ouϑ_e)Ȳkwhf=p[7ʛm3mQ|!Wxm=biŪ$mb=4KY򄖤ҖfhIlCKBºzkGw-MeZR~ӵ4&$Z{#Uq(M&᯸1d+duA)#xfoW=Ո%Ͼ&I-Kybd.۩)%\6^z)^Vf+nO9|1_qguNJ5u;X!uk%A\vjڲvWc "GW٭ė F+^$J2q-iʮΥ)h/ljo6f+>3lU^<_ZUmǦ🲝*i(*G9LicWE%ݶR mRۊۏ۽ݦъM T@:DbժeѤ MȒEMfEocֶoƦ}&BӢy]I66;DyE7YvMȘ^l̘>EUh/9ح|hcF(*GaMAa+Q[[jwQ]"kM)}ϟ}W~s|ϯ^՟7O^Cp:>/޼}/~wew?;=|^<͏/q_ݩcwwrwow"ZԎî95=c>[EJZ/տ_va:;אszйmj$YQ {Ђ3 R.m &؋X4ϬI|^c-m2v}No~ő>*m?u m $mGY_\מv?{8Rc]U(r&gvU{o Evkujkq/&g p^Ks*Zyp &lA\rFP@U T*P@U'BIp*P@UtT=ݳw^Ei(WD9>H,e{5Y-Dz})_9ibS\2.2]sX7K3^5r\{/0eos-ާc<^}.\/nkqٗay1; L3@UkT!AQ@U T*P@U T*P@U T*>AIp*P@U T*P@U T*>A:F*P@U T*P@U T*P@U|XQ#IU T*P@U T*P@U|X8c1u T*P@U T*P@U T*P@Ԉ)N 'U T*P@U T*P@U T*P@U T*~:Q#IUT=ݳw^E9G5R~(AbTޯh9O NIڸ濖q隃ǺY+|ϸ6q.{5Ƭi}ϾW n+u><{qecXs^{"@;L3*P@U T*P@U T*P@U T*P@U T*Pŗ5R8)NP@U ❉w&P@ q u:@U T*P@U T*P@U T jDN 'T*P@U T*P@U Ta @1u T*P~2|<>Ϋ=dTQ߯B lOj^-M)"ݳe]hw>{fϽ+V2gqo*(' K\߲}9|7w^^5cΏp9:C2{xǹ°ݿh.ko%'mb~o=?7Pb.4ر=t?N,Dfad[-Ɨ8ۙǗ&BPMM T*P@_FHpR8AU T*P@U T*P@B:F*P@U T*P@U T*P@U|XQ#IU T*P~ΨݳO>U{?fͩ>Ң5x _qZ]k[FYJ*g)Xʃ>=uۃֱdmkRݓߛV|fgȑ &S7ƽTkX:S(N'Ѡ T*P@U T*P@U T*P@U T*~Q#IU TQo}8} endstream endobj 17379 0 obj <>stream h݊$[0S Blc5>0:Xk#_Dt.x%1yz:;*3"ꉆyܩԭrGGk>̩}XRe6WĶk>XؙfҜ9bwZuxl>ڇ݇撲>\5=Cx`Eΰjmo^=hݑ;fxE2}?EsvohݝKk=F5{f+_s*g%rtUyD|SZJ)J_g*4_(Su;ڴlզuWߴWE]kkݽ"ډj#RfJL/G$WR"N-+ҫӌ^2Uծ+ZwoZvao׺D~J]+,"CUB2֟oV++̶fK1#~JWW5<^բYiubc;UZwZwZwԺ;ujW]Z?VwsW=*]#uLOww(uGX֝5Uc+#}xRFL#[m4vZYw(2%FmVRn+3ZZʚY"}uupkݱVk[keWUcݭcMj[k)+*M(Zʺne{-eUfԭ񊜚k)˫ٷ[UiSQ7x;Gȫʎxİn;a:i3$S҂/V^^KY^+1#9GZ̈o%iZ׺#G~uU2_\<+\_yC7"_esl#~-#~j<#j레ȯfeD~ծ9+v]_%I݊;T(]}E~VFUDUR#^#3խW[xy.;E 7lAF8DVr/Կx[".וq~%Fo?*W@;jzbm?fFq` v0Gcl+ ^Hٮ n"㖋l^D2Ll)PF֭FUfvK& O/ٶu?Jlů|L]oyj~] m#ҿu>w_<=>߽zwo_7Ino=oSc~yۇʻ!y}Fy~wpOx|Ф0}?>|?KAU$SP]}WݰYFZk5b[c۳gׇq}~sѼu{>;Ҟaq|&g>qݮ=z{s{jx_6z>W|fk;bM\/}S\GQP{'V^"R\^|\⃢|v=?=[A[]p':eL~J+.Ǟ<.ϪUI ?cnb_ >߈nRPUPUPUPUP8c1TATATATATATATATATATATAUT#Hq8 (>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPUAǠ T#I***************P4N' ?@Aqc1***********~XC5R4N' 꿇_\r?*:E>):?8~)_QAūչibx޸^Sk>fHumvg=6w~?69ۙ:?/ࣸSnss>1{(L|g;TATA?8c1TATATATATATATATATATATATIqBTATATATATATATATAT>FATATATATATATATATATATATA?i4N'TATATATATATATATATA?8c1TATATATATF' UPUPUPUPUPUPUPUPUPUPUPUPU{4H58i4N********_8c1TATATATATATATATATATATA?F' UPUPUPUPUPUPU?0Zk endstream endobj 17380 0 obj <>stream h͎dG[;,/{e@,{n-ED$ Xʪ:'#^LZH9=4GJ޶NeÓj;ZsNÒÇ5R[kGlOՈi6YؕVYZ%bOmzlr|XcKM%}4^#N9‡Hd3GnöN޺Wh_5˗^5\-uUW+r}F=F=sF6axXPU#v8ݶ$oiiڤ>/_=p}ww_<~_߿Nξo~|}zwCzEuOyw烧?<>o|?YBjKJac;[\FcJĞj9"ז_*ym5g=>l^;v=uϯ{~/Z.ٛh+ړ3zu۞C=|oױˎxڏ  :;>]mco'b7lqyg)뿭FI5Ÿ~ߊymmQDbEIQ|v_׷lmw=i?oYcLJ;7߽*o*K_U?i6'7e+̾V m\כַ8(Jqc1**********_ UT#Hq8 (>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPE5R4N' BAqc1***********~XC5R4N' a Aqc1*********jq8iPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPU/?jq8iPUPUPUPUPUPUPUPUPMAqc1***********~XC5R4N' a Aqc1***********~XC5R4N' H58i4N********SEqP1} _RrI endstream endobj 17381 0 obj <>stream hۻ$W7_.HA W!Xq Kz{핱rPή̪R)י>Z}TGnS˽6-JÚ|R'b{EH3dFJÝ֮{nsذtrRcKM%E35"Z{nc)gDߙ#.z:_wQ%1jYWE#^יwnyXyOmOZ[[Je_2=^guIg?4>9g}_[#^* 5<Ԯy׈.֮5#^՝g/?+5%&+[]e*#|{2ݑ_]Q-=m\sD~ְo[3vjwwj3"SUswΫ"Zj%;G~JYwngW}%/;Z>ּs׼׼딈׼{̈׼׼g͈?IOl<;K*nJ׿3[]h5;=<^i5_= ǫܑߣy]5.ׯǞ35iׯUΈy_iU趕?iz K{~bF|; [ěTmE]E]cEkO˟!Hy~V*w(+]UzWEd9ed3OZR<^^vk\ҍxdq"^j#^gG=FpGQJv4>ݱ]nj.K?kZx~fQ{~jxU EޫE~ڽsx͵GW5Lk"BNO5V Z"xuIkYC-D~Uúwȯ2uVyNհu.+b5艹ߩsF[<=dGL{3wul{wd髲YE,L_iDq'ys<-9Zۏޣ7Fd]q-ȷݖl{"ֿJiӏ>9W)ѶvLdFDڇMw,E1]t[clm-KCd%HDji_<ǯ}xx?=߾w߼y|z}ۇ^Oo_Ryc_><Ȼ!_"z?LJ7/>_=餏}>\P(t)ȶqӝ߆cW}7}^v/<~Ylym۫^7w[Su:vkky>6g]WiYܺߓ3?m?u~c:<__=^Dž^m7~k!v>~/F7XV'xq}oE`n}QDk1^}Q|RTw]h_m^p'+16kUSqwUq|WYs?(۬P3;V `= *********-REqP1} PT#I*********~XCqP1} PT#?+P|Ǡ F' UPUPUPUPUPUPUPUPUPUPUPUPUT#Hq8 WTQ}>F***********5T#Hq8 P}>F***********5T#Hq8 P1}>UPUPUPUPUPUPUPUPUPUPUPkFIqBTATATATATATATATATATATATATATA:C5R4N' ߨ8(}>UPUPUPUPUPUPUPUPUPUPUPkFIqBTATATATATATATATA?8(}>UPUPUPUPUPUPUPUPUPUPUPkFo 7 endstream endobj 17382 0 obj <>stream hˎdW7_$V`Y0ch^0Y~{Qg;BEgU9*u̖r*G#rg*MTۉНi{RcWNT]%=v4Zس9JĎX>i+f S/쓧s:/>Yi<{qp EO땖[oJVx[>ֿg^_5iyWǚwm4+"ͫьMxͻFwh^+;5=^yD~unk^jOk^UE:uʶ.n]dG=3L/wnZN͑_yuD۸$UKȯV6URCU"^wtiWϞ_U9-5uNO\нAbؓCqk=YdeWD3v"~3lD.F~Û_x|} *>O/ۗT=~dXȗoo<|LJ7/?==鞏~Ap٧wKU2g6Uyv{+z\skǮ_O;kY˸Y$[SXgkWUo&K'gkvϓcN_kv}lk8t?)/WmiעmmCWot1G[]!\^|,&Cׇn :w ~^{TŶ^ l5?M37UPUPUPUPUPUPUPUv(>FATAT?F'?RVEǠ }>F********* T#Hq8 b AǠ b H58i4N***********XCqc1*********XC5R4N' /P1} /PT# UPUPUPUPUPUPUPUPߜRT#I*'H58i4N********5QEqP1} Yjq8iPUPUPUPUPUPUPUPU)Hq8 AǠ /P4N' /P1} b Hq8 b AǠ _ a endstream endobj 17383 0 obj <>stream h݊__LuCWIB./kddB>k}'`)q̇:ݫjW^cXmKۮ{z۾5Ϻ\IgJ[IzsJ7yRxluͺZB۶fhЎmڹCYkv߷պa۞]hz }ߞB^1->o]YZ+}>+n%R2C/gwz]Zޮ1BM5^崺˾gח[t?oWfyo=c-OG \]U}Z] Wŝ#S++v ؊%S>CI^ &3*w,Zڊ%⎔B+zLhm]e^ZSqj3u{ojO?!S3ЏgO{ ڴ#P{jCq{}^qGI#JTȯL]=+׵G~U^"3":-z۲G~5s=-v#ڙRW纵h_j6jWS)6>ȯv-?jD~m=]3k:<6%F<<^z]C)]=CB?7zjvՖt>KYӹjۊ╦_C3}79Tƌ> ޱ^װBj =l:>+nt mnO#c33c3A>T>v4}̇٦tccʃaN+Ǫ=طJ_|/,:pv20dl'ᱳاy^zw//~o&8%}ˇw?W~N.ݫS??~{x z/}w?~xїKFEzZOC;zzvo=)gòeq-j_g6ݯ홍qwעq\=w*nq;x8Sts}ItDϻ0њξ^g<&qQP /m7OQƵ>n3&D{5E8x^WS<3L{fh3u=iב31־fJ;|,>]%Vi٢2;sĞ_ snCc9@U T*Pq#IU T*P@U T*P@U꿁*́9c1U T*P@U T*P@U T*P@UF ' @U T*P@?Gկ=zً7FG^SV4Q{n9?ESn<|uhqmd՚Wƥ9}E>3sf8wv:ZSj{gk'ت5wv2oo58yG`>Y:5'ʼnhP@U T*P@U T*PwIp*P@U T*P@U T*PE1u T*P@U T*P@U T*P@57R8)NP@U T*P@U T*Pk0栎QǨc T*P@U T*P@U T*P@?Ip*P@U T*P@U T*~X9c1u T*P@U T*P@U T*P@57R8)NP@U T*P@U T*Pk0u:F*P@U T*P@U T*P@U T*P@U T*P@U To^?d4rn^>~ڑ׍ؑntۤSEzfw˲{fFّWu1;3'N}^ oپ\Ń q#Ep*P@U T*P@U T*P@U$TaAQ@U T*P@U T*P@Ip*P@U T*P~>,?ͫܟ[:2vu#-vqE<-/6sƲhw{vg}+8ɴ}vz[/|| _e@U T*P@U T*P@Uq#IU T*P@U T*P@U s`u:~%) endstream endobj 17384 0 obj <>stream hώ$GW@S?S,a'@^q#<=cͮx{~5[.XBCogWGUfUD~;ӑGhu؆+նw*u+Ǒњs}uÚ\Ro5b{Z>dDLÕ*%l9=Qg9ֈh7C71 |Κ;E={_4r"^W%535._43hV|Z9Sɣx|- Mi={*͟C#~ҏK"^* ~u;4ۯ4ʑ֦5,Fb$T"~6zTsܶjZjdW٩eGzo/U^#kGk1i"s?b/"]GHf+,h}fy5{fy5Z}GvK9xͻZxͻxͫYzZ*WZ7눲J'f?~="~j{įtylW*9kkȯZ*K'G3-icR#zF:bqiR˫x]aWrkmԈoiw+=wȯz>"^W{M߿?iUZsמn$JM 32,aDE6@ A߫D ߆҇y[#u9vk9{[ UYc+P9fE}@7Ae9k }XZUGc?g5~ PbYxIQ[^EGKnfgmc>w_>?{û?総OT~}u˻%;;yyk3̻pLJ7>xӣ.~߾~K5&#U@h 1*{JkGD:~Ue|Cgslv={leMcvz=/]e.^7ogr~׻;n^}Xy;n5m,|/,h~ڃNx.naywJ_>?(>ƽ?]x+KpE).xEQQ];?[ў?[A[]p'z}_3Z+. <.Ϫ2WG7e/+ι@z#z8 TQT#I*********8(}>UPUPUPUPUPUPUPUPUPUPUPPT#I*********8(}>UPUPVi4N'TATATATATATATATATATATATATATATAujq8iPUPUPUPUPUPUPUPUPU?/UAǠ jq8iPUPUPUPUPUPUPUPUPP}>F***********kFIqBTATATATATATATATAXCqc1TATATATATATATATATATATAXC5R4N' >FǠ FIqBT8F' UPUPUPUPUPUPUPUPUPşyQ1} FIqBTATATATATATATATAT5}>~x/x,T)ZPT- o7|׭e۵*EުQuse^οVY̢}tMq}/'k29TmI=~l[wnٻezQ+[yXJ,5sTTATATATATAT_ЩFIqBTATATATATATATAO?~D endstream endobj 17385 0 obj <>stream hˎdGW7_$ .^B `p/֟3/ww:%>V95>f?6b]C[Td_IkT{RDx׼wHEV95HvJZھ4>۾S+3Ox4ZS9rw4gwF6vW;fjƶrwh5"CnRUEmȯNohD~X[]]"ˮ__IgΓȯG=D~DְJwi5wk"+>ߥyψF.ߝ5^_](m{smgw4aom*r"ޘh_d"~1FwkY쪘ȯ34ݭk="Gmyϊ*3KP'M`Mwt4UXUmbj"KmX5535<5535.uJonVj=M^ߓC#~ׯ \Ԉz;OZ={~%ƫ{F OxyfyWx׼۵X"^^"^8k<=ZPz_i?I݈9?imj#~*V2<^wբ=^^m;uȯKW($+_G~#x<^<ޟl\5^_yuz*WkYzk޹"(~UY']={F~sJW^#`n`e ^H]lu5{ Ǩ)e[{qʼn45lw\D[PL/[le+;rmS[cl;8ƿnHIOq-H]b7SDh0Ie n#"6v1^H ׋c/N!զckWEslE@nݓW_/xxo?|NUǾ~߿N˷O?~|VH߽EO{珏z|烏s>&bO^^dUݧsObͳ>u<]v:޿^svޯqrdqlM5׳3kM@s]&ƿ({q>O9}w5v1vKϋ#зϊ1:nxmڵhdېBg_刼^{Rz,nWE®Wu󷢸=Znɿs=="=[Au|ŧbw;UBzϾU|&bl7pߟq{~7 UPUPUPUPUPUPUPUPUPUPUPUFIqBTATATATATATATATATQ}>F***********5T#Hq8 (>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPUAǠ RT# UPUPUPUPUPUPUPUPUPUPUPUPUPUPUP:C58i4N********](>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(>FATATATATATATATATATATATjq8iPUPUPUPUPUPUPUPUPk(}>F***********5T#Hq8 P1}>UPUPUPUPUPUPUPUPUPUPUPUPUPUjq8iPUPUPUPUPUPUPUPUPUPUPUPUP_ lr* endstream endobj 17386 0 obj <>stream hn$W7`//ZI!X",. ODtqH-d{iנYѕYQ_`)F/>ZlÝjӇ'v,iŇ%kN׎؞F;سp9JĮX>i':nh_":3t]wҼD~}ȯVw.ͻwwi3"뤡rxemU6xv@-jWacoKW3ƝJތ߭yg\_egՍu"G=ȯ g O2sjf>qJYzWDZuk<=CLqx{~*)OFcͫEU/kgkޝJx~m7)_;D|OC#~UkxY<'-IWi9ߡQJj;#^\#^"^Z"^ȫuzx{vOwWv)_yk5>'G3mK"~0sW?͑_^5YZ_ywʫOWϬ?0򫕟kt"h|"FU6Oˑ_4/Pʫ3zWg8*܈׼*׼E~Q<^^|"Z9%R\E~"K'2,+G.VݞZ5ZdYjL<.f10cD;2H͖\/[~3KO9mח1 "SEmt5s"ۿ ȺW(XRD-#*H +E%qheV/+KuQgNo9>c+Э{g=p|wwwNUǾo1;r -✻o~?{w>^<.}??|_1">_ߩTa:u]_؞;7k[97'w8IYM_} ׅ7Ml[\REx>ZocǷ őmq)5_ qkӮE&ۆWo:eʜ'(GuI1^أ6MUݞy]I{]^_k%Z׼jo NjzO^ U!\TLֽ^滝*Z|Uٷ*ffk!vvi7z蓮j*******_;UAǠ F' UPUPUPUPUPUPUPUPUPEqP1} _F' UPUPUPUPUPUPUPUPUPEqP1} _F' UPUPUPUPUPUPUPUPUPEqP1} *jq8iPUPUPUPUPUPUPUPUPUAǠ jq8iPUPUPUPUPUPUPUPUPUAǠ jq8iPUPUPUPUPUPUPUPUPUAǠ jq8iPUPUPUPUPUPUPUPUPUAǠ F' UPUPUPUPUPUPUPUPUPUPUPUPU{4H58i4N*****_-U`ݣ_ endstream endobj 17387 0 obj <>stream hmk%~cI|E,wV&TՌv$]1ninMWw\k\[ڲ^mͣ-϶<\[RZ0oaٚ2]B|7ZxCff/3e }IWS|u; o>+EVvnRs-__HV RrRY\7 ")_UY]xWtlX(vbE&eFks9F )G.]=wQ첺V Ӯ3Wϡu4S=:?t^kGy={\eyxw\qڱv;ƱRtjoXҚ}<'b 66~׍<-+VcEgj\b!k乹WQD˓*gw~o=?Mx9]_GWX|*T\=LeV٢fܳN` ?OE T*P@U T*P~97WIQ()=l=@ޜ{ґЏFzlNyg/dc>gZGMqW9]ۿXgIs<[~m*P@U T*P@U T*P3D@>*P@U T*P@W@Q#j81NP@U T*P@U q | @U T*P@U T*P@U T*~[5F8AU T*P@U T*P@B1P@U T*P@U T*P@U?A81NP@U T*P@U T*P ācU T*P@U T*P@U TXTܿjdjd\#FrƾT-=R]VYyN-\K+@nmsyԵ9CC1g6v~?өC_4/^r`c5g.R.KT*P@U T*P@U T*P~B81NP@U T*P@U T*P1| T*P@U T*P@U T*P7ācUqc>@U T*P@U T*P@U5b' @U T*P@U T*P@U T51~Y5 8AU T*P@U Tcuā81| U T*P@U T*P@U 5F8AU T*P@U T*P@U T*qc>*P@U T*P@U T*PQ#Ɖqb T*P@U T*P~ZTGW;| endstream endobj 17388 0 obj <>stream h]kdr@PEI\\(k bH2!>OUюN7xZ35tUj`\G:1zG+bk~=#&;gĮcXuxlNNy09#WgLu Zm|ۍ4c9&n2&i5y|Qdʽ'/w|yǚwݸuxSxxmm*6[ZRժߔ}mkl6GimE"^8ݚE< WdwK!J&o=y~5qȗS#~:55H_]Ag{OWF x/زKubxͻGW+TM䈟ȯRnRCUִG_U3+7QCE~"_=5X_ygyK=^oJF~+; $5 _ݓn>Rl/hm"B+*f۬$3 "f t3#זJ 2n@Vgl<NHWm""qeX%x٫ TetX"vL}_^=88ja{;yHٷD-y|}v/^nwǻ}ßû>*W7_?=ۧ#g{~t㓼k3̛˿y;<^Sx7/>UgRo eKب/WXKCz}5bHbT"Zgkv*ym1?α=azS5y·ߋa{]ڳ=,n^|ϯwy\_N=z:oZloX^ްoң\pׇE\o)j,?YM5b(KX"ͽ.Hqy-q]og+gy}{ٞp'316kUکYqtUY\77e+>s){` 덈?O**PEqP1} j߽uQ/"DQ/()i5?ڎsm@ *^/nl#n'sqݜ5s)W{ݒ|/ew\}zkڵ/>y3u~/:{Qǩ^k{>Ϙ= D@7x  gQ_TRt)]/PUPUPUPUPUPUPUPUT#Hq8 Gjq8iPUPUPUPUPUPUPUPUPUPUPUPUPE5R4N' g8c1TATATATATATATATATATATAXC5R4N' ⠏cPUPUPUPUPUPUPUPUPUPUPUa H58i4N********k(}>F***********kFIqBTATATATATATATATAXCqc1TATATATATATATATATATATATATATATATATATATATATATATQE5R4N' 8c1TATATATATATATATATATATAXC5R4N' 8c1TATATATATATATATATAէlv endstream endobj 17389 0 obj <>stream hۊdE_@@`#C{X 3dwuᙱl$5jgFf>+ Us#Q%ڨ15Gep)OIKȡ#Qm" QpmѲٵ%q 1r3m ǘ񘵙6#-ǬqV˫z%z0z0\LֿsƓf՚Ma[Ozv=KgrV^fLfWjCj)fk4}NGJ>g{p}QYru}~ƽ^qUԩM/lz]XqG}f+^Xe2*oFҖ~=~9nzU'iUfʵ#M_ƽp9j<QU=VUIRcEy RSY=VCp/iRKL%V or}֏~hܫM,%Rf1}GŽ}6VKrH9ʽwRWKjͽ$eM^iK#5*USs/)zɽ^ ٽ4Qkp/`׉jK%^'빗^ҿu4Tgr/^d":WoI>j-uVjѬ:k5nh:|bis"U ^u:OCTECڌ1Iny2]_4U() '׋96aQbyU ^<UoYWσx%rW+KH+W9Q|.rWъ\ڦU|W>gnmzA9.5>1]:U5y*('n]d>g@L벺X;P÷9vmj6GӭVY[u9a> pV9O)J:]l*r?mʫUl*6gv Ӧo~ywoo^wo^w޿۱oxnx=HMS17??ݼz ּe o{3E,^Swz]<;ku.ENo^"P/9X|}\Ej>/+zo)s\Am<+ *Všcmͳ8cچ/W;>i9D񏻣}gwWWBӫA[x֨rV}mE)>*Dpq]KWO8v{?^3מ1ϗ9={L돮x:px;gV+/M\&rfwS 7`U T*P@U T*P@1}>@U T*P@U T*P@U T܈i4N'U T*P@U T*P@5>F@U T*P@U T*P@U T*~Xq#IU T*P@U T*P@U?T}p9?es/m1l&55֙#496l&xz_Dч @U T*P@U T*P곯oܿ4$;kaO֫txc}aTi9ibߨ74vog.{tKo7ƙ֫Y϶Z;>k{>stream hˎdW7_$V`Y0ch^0Y~{Qgw/ʪ:'#J/gghbopI 9zZaImÚzӇ-#jĎ4ΊؙLJ+"vkIM-9\Ro̹~/ 5H~lIߖ[N&}o޾>~Û_x|}߅Sc_?|߿}Io_~|!_EO{޼zk>Os-NvNa_|5n5vWu}{zm]Nyx9k?:~lM5sٱ`&wߵ&i_ȹnm[\vog{='ǜ׌x{}~\8J]\㶁צ]M ޽c+skOJ]џTWؕqCQ~/_Wm}WxݞCA؋dauBzϾUkLx-npq{~fo BH58i4N*********⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATATAAqc1***********~XC5R4N' 8c1 H5W UPUPUPUPUPUPUPUPUPUPUPUPUPUPU3T#Hq8 *⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT⠏cPUPUPUPUPUPUPUPUPUPUPUji4N'TATATATATATATATAT>FǠ a H58i4N**************************~J5R4N' o8(}>UPUPUPUPUPUPUPUPUPUPUPkFIqBTATATATZ$s endstream endobj 17391 0 obj <>stream h]=_` 2l\\l%^%# yjz5DRs1{zy뭧f~Yzm[zۆc1}8\I<}+uTsaَ>B{l֭Z o}[{h6Jsힶ1k٬͵{E^Cwv7zM[ 6X#a3~z[~Yq[꾜Ksg)̡ov-;zŝ^Gz͖Ө/y9UחqO?R}Z(mGoq?B-GNCqY=wy2I9"GJ:"Gߊq*z9<"])GMHE"df+cmüWܑf+ ez,oq:F[NqոзM>(icS>rfF4#^nK]S&BtVBcCjJ_YMk%u?c^;ec4B--mU }xЏMnWܶ ZwT^XhWFĐ*CRj-#*nyw/iW]Z٭B;V SME6}|h<{T+n[5FZGR>Vmu eCϵ{kzx(=*=MB/DB/FZ!xj=UT2u*_uUt߹Q޲sCyָW~87KuUl:;U7zm^qUW\ջuSze Y#w 7`%U|ܡI%4e̸[=JܣT$U}3i6'սcn9ENjڞ}+Ѥڏ{l*~ߌeR=Q 0LgP[S-۝c9MSRLWw(UK͞=O)6+jsξk%&[{="ev`<`5Wcܵ9ˮ=aU7}{W7/{Ww/n~_MpJz7o~m{~}^1޹䷷KW?ݼx {Mz'}st7o,l֒>֒NE_e;vo5{un&y|s,œ7Zc{zYaMEl5u~.ߋ-c>g]}viv3Y|uosgj19?[>.t&#>gW;kpǻE\rgwJ_>vc'nf0iK:ܫ)"ь뺚≩.ʹk_w{5CkX]'gVWbl|+*..Y \_*5=ٔ]flGWìZWO@U?TaA@U T*P@U T*P@U Tp#nq8i T*P@U T*P@U TaA@U T*P@U T*P@U T*Xq#IU T*P@U T*P@U s`}>@U T*P@U T*P@OxՔ#}X#$H=Y{)_t4-5:Ekfy߫GſWџqm ͽxν\p[.y9ay՘]"@3L/>F*P@U T*P@U TWTFHq8AU T*P@U T*P@U T*X9c1} T*P@U T*P@U T܈i4N'U T*P@U T*P@U ThP7^=<\SC62scށL{9s[&;{!qYLW/oQ$_1ǚEde5no83ǏAчC!̠ T*P@Uu_uOчC<20栏c T*P@U T*P@U T*P@ U78i4NP@U"UW@ ᩈ"@U/`}>@Ug܈q#n18@U T*P@U T*P@U T*P@i4N'U T*P@U T*P@U?*TaA@U T*P@U T*P@U T*Xq#IU T*P~<䋇o_^M9G5RyjAbtߓqNI*\ӯc\dogz$_{0coƚsy}k:ߋ 鞧zs֞W%- D"@?R /{>stream hۊ\W/f` 9I0B.B.{lH2!o ܙoӚ{֯Zؓ[HGq}4 בg>GBGJG50r\vZ"}q#v3u̙#vtX;yۭyl{Ij<"\v7_MVڎx]|;cE֟y|?x[~Mʊ#*kk++ YF)*ws.mm*1WަsiKnuRrZ53RKw׈qKϣ4"~ilb=^+%_ePf;-soowww㨩GͩFҸψG-% H٩eEiZ[rLD "MWfw+(#EՄygBwCsԵkgnQKϖRPͪ;jIWkyF~ۭ15ޑ߱VGw죵 [[_eW5,_ݵ>ּE~mw)x=ɞVx[|\UIU56EneLS]轇KPz^Zk_UT;5߭ywj T|ʂ'* /t_xj:o_¡sbh\4ޞ)Scf"4׼c;{xͻwj/_LJNyfķCq%cD8IxYw+]=G>Tm٫Wzԡf֦׼S7cͫ-xͻwʫێxᜒwVߩWV._YjV"]cYQ9ψX*Ɉ׼~2_yTn/$KW^D~͵-6V)Ex_-+vޑ_]aWj_yʫjWժTy_U5h|=J*S:!_ݩd+W[A? #ö)H- Sfj5TN78YqHFi+qLPqN+H۲Γj=!N[>ϪIyXmZk<-'i&0'j4KgֺX= r?O$ӓZq[-Z{׫'um+Xvv?7/ջݿxWw^F/>{xoywݿ^9{ݗ?ݿ{>xWa_w,_oͺ,3[9=~&bͳq]{sx+~=)Wvv {9kwHg^`{&i7-2{uUߟU{zrS]tk9'Ŝ} OH-'őpuTǹצ]M I7:eʜ'(Eܓb<ϫأΟWE<+iUy]qXLay՞ Njy'{uSc/q:Wfϫz:5ړ n"n7zOHK5BTATATATATATATA/*⠏cPUPUPUPUPUPUPsji4N'TATATATATATATATA_^~mQQVOr}POdT:]SZL9x^7WFM"[kkX綏c״k5׾yvEq=O:ek:cP,ߙw&***jq8iPUPUPUPUPUPUPUPUPUAǠ jq8iPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUPUHq8 ~vTQ}>F***********kFIqBTATATATATATATATAXCqP1} _F' UPUPUPUPUPUPUPUPUb AcPUPUPUPUPUPUPUPUPUPUPUb H58i4N********k(}>F*******PIqBTATATATATATATATATATB`eUa5uڇ>{yaLr<IËMGYg\69q^/kq3*s./v\,֋ǷFA ߓF|G;:TATATATATATATATATSEqP1} _F' UPU#Vvd endstream endobj 17393 0 obj <>stream h݊__ '1l\\(ؒdB>Nzb'u޵{_aNns#YqzY+]v*G\CoV6+ϚGi~)S8]/w;kmm~+zeZ+.QmXQ_SjQ_jS<_Ux}my}(5ZNx7wŶS,Vvwz5!0^u8cmx{}3&ixz!z1RCيWKvLwz}x5GndC++ʫz^yB/8BwWwWW8[FS9B?%~*=ОߡWޑ,wW3Q_\^nW<䃨VCj4c~ZӨإuYj5Wg Y!(;{ܭ}yزXyjqjjW^R׋W[uxULkwZ}#-{lJ2$5 +QR7'2b jf-&~ϴ}ĪY(l9Xn d۴q@cTMh _0>9|skVs{e@mElKc/m;,glgzSqxܾ?@U T*P@U T*P@U T/ 7F' @U T*P@U T*P@1} T*P@U T*P@U T*P@578i4NP@U T*P@U T*P0栏c T*P+F' @7F'T*P@U T*P@U T*sc1U?VIq*P@U T*P@U TFHq8AU T*P@U T*P@g^>F*P@U T*P@U T*P@U7F' @U T*P@U T*P@1} T*P@U T*P@U T*P@578i4NP@U T*P@U T*P0栏c T*P@U T*P@U T*P@?Iq*P@U T*P@U TgT}wϿ{xqJJGG=Ri/uϖ\*ӟ{u~tH/oym1{Yg9>>stream hۊ__@::b* REȅYc$_U[{4`__mavj[ڲ}Shl9r{k+eݧ2V0ou߻ek= mڬ[#cvnЮm\-i6m4=,ZBo9ꦸkR[zm:Kۓؓ|Şz[׸#k1fwzk^VBդ\_idkSJ.篞K^*{}+57}}^S⹇~n+Ż=rĕQ#ځ2fdU="])k5"jQ#՚VVЯjaoIq\VL:#Z<mV7Mqʮȯ>"ڽ:oӸcMw;{kܥ,y&j'Bdxqk-֩k4Ƕ^B?xɾ=\(nNOɡ׸}vF%S5ZqgO׸иk,k(ˁ-ze3ځVPuVᙩ#\m?<#WvRCYWz6ϨU^jf9:<B`^ql3Y'Bij-B߶3@s ,H,Xuc3!Ն뵊!~Wv_?dg_JM2Dga(rI۽ty'L#:ų|dv3zfɫ;;˳I7ks>]bpt8u'~y2я=7NXhxg_lc<'b .v??Mz#gf%׸hPqZϛqŃ\P@U T*P@U T*P~TFHpR8AU T*P@U T*P@UɃq#IU T*P@U T*P@U T*P@U7R8)NP@U T*P@U T*P~0栎QǨc T*P@U T*P@U T*P@?Ip*P@U T*P@-P/;[CJCOɴt OOMlBj}F*ffokgs3On~nIqAՇAxP<A1u T*P@U T*P@U T܈)N 'U T*P@U T*P@U T*Pk0u:F*P@U T*P@U T*~Xq#IU T*P@U T*P@U T*Pa 栎QǨc1P@U T*P@U T*Pkp#npR8) TFHpR8AU T*P@U TP_ endstream endobj 17395 0 obj <>stream hˊ$W9/`/ E`xaK`͈o/"*gjl~|Sm'BGjGLm]+‡;}i}8Ɇ3YWZ>;]#ݗjΓǞ\{t/$xRgJ+=5G['skzE*vz6ּ:Wj;s>ּ{׼cz֊5>KI񥦪 /M]"FOO -+Ց#ګ)MʂW;O$j#Uiՙ(;5i-5+UyԈ_jjğjVݽVt)jjx~펵fw\:gF#G][xͫ{;5^S9ۛ3;KȽSU#]+ZmF~u{o_Uc;;JR"Cwȯ2W5Sxͻ{whSrk3#kY%"&+dםDm94^9{w.ϊƘ_8faȯ;=^W3E~~eߪS#qֈx{WweD~> ,i̺ߦ;]jl_-TmE]E]cE۴~^_~Ғ6_U)+;J?4^~RGy"^F?i:WխJ{>6}lKl9ڜ6k!>{!%l#+EElU*^QVTX%ن9QV6cG[͟W[|R5۰ӀrL{L(w=hcFmĺc;Rog("QH=-zǞFqDXg=/^z~x?<߽|ǯ~7~ӫ'k79}ӛϿTl_?ϯȻ!{yE{/I}Tx7߾5[0e^wƶ`{Fkr}-F%bÚ9"aMxݎb/ʟ}eڒ]1{~zC>zwui/[{rǻwF>q{=$z> :;~gW^'blO}?y}gwJ_?ըA5b\([X"{_}Q|PTw]VmVVxp'+16UqUq~o[Տj#pQBl[s?ތk.)*****yQE5R4N' 8c1TATATATATATATATATATATAXC5R4N' 8c1TATATATATATATATATATATAXC5R4N' 8c1TATATATATATATATATATATAXC5R4N' 8c1TATATATATATATATATATATATATATATATATATATATATATATATATAO*jq8iPUPUPUPUPUPUPUPUPUAǠ jq8iPUPUPUPUPUPUPUPUPUAǠ I/~O_?*âܟkkr|t;/<+*zu:7Mkmdus}~k=~o9mk9ӏi.x;u +u~-ZGqzߎep]X " " " 7x7*************************UT#Hq8 (>FATATATATATATATATATATAT5T#Hq8 0H'jJ endstream endobj 17396 0 obj <>stream hۊ]_e@>r2l\\(ؒdB>U53RṙXڵ5G:^[vk9m3בgnm-GYpmf;z-ۏFqsL=|1g}7clY%q-_vw߈ق_3|Y;c>rnk/W/2tcWYfsY: w/m5[IdOr*oJKie(G3=j+(SIը2[dUZV6]cIfϣժjN3m Wvjv%چ+UnnW٣j =0S+;wȯ5#B-+}J!MΑ_\)? ++%9fi"V m/;lwF96⮳ ">z:KRYiFK*weգUnsfuD-DҺy*5[q.dk}cU}}fي;WqWܝr+#)UJ:MYy7b(1T"{x05$Un)g`]tn)J᯸WܹFU T*P@U T*P@U T*P~NBIq*P@U T*P@U T*P8}>FU T*P@U T*P@U T*Pb jD4N'T*P@U T*P@U T*P@U ThHq8AU T*P@U T*P@Q8}>FU T*P@U T*P@U T*Pb jD4N'T|Q7/`e0ϚS!ڀ#BFU T*~C!}GfP@U T*PQ#IU T*P@U T*P@U q }>@U T*P@U T*P@U TԈr5w^~(Wh\>`\&loW(:Ͷxꓷ9xK3HmK?ycX^}N;x}y+u<{uek|՘]D'xyU T*P@U T*Pf}>F*P@U T*P@U T*P@U|m5F'T*P@U T*P@U T*X8c1} T*P@U T*P@U T*P@U T*PQ#IU T*P@U T*P@U T*P@U>58i4NP@U T*PqT['( endstream endobj 17397 0 obj <>stream hnS1_o{/!P @@,rH4홟A8 N|OflUC=;?+9iT]<-asawHz sKѥL\d8iX0mu5T6Wk0mw-ZwiH.x Iqͦ晐|8FL HV#1o0dza7Ťz⿩wsT=q]^.nTuEN@纽Tȷz>b 9>#Y1r\%f]?PZd(emhQLuyTzR}5YWm!>qVNX>I:>YkSucqrH$ÓI{9nYݹM7|u5N_og///7VN˻狇nrBs6.f"y /߮tzI''>NkWw7|Nx+j8r3F̲1kVєO޽%o9s%?d!u^)ULj)9RƜn9X2'.)CtxcoI3q=#̇fg Oy!Rc!aA9-p޽n_'nv3[x04rb1sSjn|ӎC?,O1oaxm>stream hބнj1 W$CCNi p :~dQ P`Afv ^C{:_?*SۃY 8aU,Jӎc S{~[n=_lTcUxg8XEH2l (zj\SK̘5  ^ԍ߰0T\ endstream endobj 2 0 obj <>stream Hw,*LKL.Q,HUHLOUsrqVP(T04023U0Bs##=K kg`k T `i endstream endobj 3 0 obj <>stream JFIFNAdobed %"  &)&&&,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,  &)&&&,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, N  i!1AQa"q2#BRb$3rCS%4cDTs &'()*56789:EFGHIJUVWXYZdefghijtuvwxyzo!1A"2QaqB3R#br $%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?ĊgN>J φE ߭<{T!r{?P >UpR5ׅR&BVCQ!2ύBT!}G Q!urBmZ9!̱B רA O*͸ m 1J1&4&T!=PBCP*@z!@uig?<~ɉTց;!}֎M,M4nT4*n'DցG]}*kD >ʽ*jDN7JD' J[SQ(*o4u"Q2t3TJQ:'H5,yC1*Y(&4lyFbjJq:T!A? -j:HӍ!x^uC^OCPoP§>rdyQ:}*74'0aQqRp~&fEf~4{C~5%$w[PJ4HttuCIBT!а/P` >u$~ut&uxT!¼ -pPUCfC_ 9"9ځ?|jJHMOpGO֬P-N@$|((['.𡨔u|@4H4IÀnO*#e끚9y!0\%A@ oƫ-` SyLj6f2d5Ŵ)m± @,$rAX}[oʥі19,#wdDE .hJcI;!h9`Of,Dnr !xgAPJ"a+9N'0jX :Wvd$@?C]5'^hbr]$"f!|¥(K-K0e`)7Z9)JIh>BUsܲH>cZVs Ia<Ʀ ]Ky < `PT3r|hY5xi@ `v0}4<а9VY*:h~TPCD*&"R(lᇱ>!CCA6JNG(h%Nϑ(<\ J%.TwLHuA١){ M +Zk%5m{ kT); 834ddҗUʸAdg*I*DzEX(u훩 ORB!r)Y؀"<:(I(=I| J@̯ J;5w\yvJFV"JS&:]/]¦i#bviB}$EMD?%3-rߑ6vRㅁmK:N'w |$TM"UnD~4uH_)Ҧi”L^t6M#10<zPJ:mb`󩨔2wi ƍvR=)uHn):=8QM"lgiCuɤmCBLp: "m|jY(w8ۂP¦i0yi8S&}m$[:S;&'ZDtRtA* ayK䌀4FݖT)7=jk& 4b 3z^,skh&VʮM'U k#APd!;Iv:QɤwiR`@S_4N#0 DGY4wsRԒ#hk&I  àDy֦ ӺHPw%J< 7<{T leE2DuK àC{ s":4#uЈҎi:뷩 T XH NFNNt+C&ַ1.'G6h;Uf &ӔO t =E(G m@w0]QA"s>oG_4uhDH55?Rimnw'ɤlL)|@hj~pHD_TI-xkqjj~҇ӺMcʆpot[6m&M(GQ PBjj~҇6):jA==*J:eSf" oŽM'-6:ɤI ăֆM"?(x"cS[D$nb@ ߌzɤI ̘fY4 CS:hU2:T J&gC[&7[!!Rz?*:43̞Sx;M'SHW]OlN/sʼ ߬^9|T𵩔BwdO@TQAlĞ"/C&l,3Y4NEttnewb:XMNwIΧxM'c9p%FA‡xMUʴd3 4 ]Py@%>hp&3o҇xɠR>LT {A͍ͬ6i g鮔5H7b$Vb~5An?hx?* #&q-dTi$ҧxMŷ*Daz4u:Z|:7!DCA#X4FFuAe#2GʧxMN!$>5A1O)4 V)"꿔U;hnfdjwy[B{AԜf9o6i:uZ4zQ;iovԳD ɠR7t 񩬚DTP'5H7qCSs :9JnmM")&u*kM>155H݅G'*k&vO:ZV(~WA5I1 zQM'WtOK m;JMS&&ٻdu{Y0UoN55H:<H E X6&& MMaxnס^iHbIMd4v2xy5HvCX:4SbTz)& #0sxCjPcP>:T!ˤ:<Ρ6#_I*4;Tao'̭J#^d4@&٨R@)y=;< 1 DLۗX)Ijx ( Du2grʢϱH':()) A8̀4 4O*6C!0U4?1@S2L~SB:jy9g[@3Pi!JL9,#,AyԲP'#c P <`)0@:AT@6 =}A3 a$A,?E@/atyJdqv"=h]Aى&@xEHl|jj y"D=yXAI٠԰(_zsLI>U,х8icpcC jN.GvS$ͮEK p >4[xd%9yJ<5PeTE¯0_*w95Na[@NU N!З VNmϕFAJpǻb`TU.XtN]jXO%;#PDJ`\P.g"I6Na$'XQPt1`Uyljm#tFBg4x+N8=Zn|*CJSiaRqx1:&$:2 f'NS΍+\*uxF'Iҁ(h62StapH'6iRyϥB VTr)υC oEA5EjRc%eI |p0"'KgBJIIVaCI! "cOJDj ו3`.IVBG06 wÏ B ,zв eDF'CٽIG!I'A2*JGg $ PN>8QJ$a!q7!3(Y(iWnIJgp( '0->^.31nhY(F,&I1GP2H#0NK% pr"&5?andj£aťM qHL]+Ote#4Hy'*朕,Ҟ,#ʥRBQ5H-%) Jo#,,1uk˝ !㲛 P$ALt\|oFCna'HT~"(Y(6Ѯ ':u, 9 TLCe% GSY(}1=A>U5Gx>4,e:ZFʌ(x~t aTH TУKC<AK|I8ğк *xa43}o r[((i;=MAC#4ƍeN\:P 2YI&l{XdcbIR((l @ >l-`I1N`jY(R6m#<(PSNmzPa+]79s)5Nw O::COltLɴ^(PӘ0`W󚚉G\3x1&$Zp7JVH*N amlm=$G)!6ĔhF-pBxUڊ[YŨ6Ϋy;a4f&`hnT\ďҚ( 1?94IDc1-0% 0HJR)Зm)̲|55){- D86. ( -0}ȂtmhS F[.-4{>@ 7uIѰ0i=Jd}բ})a#w6{Z؋/gDwSkE6 쭓*q4ژ))i?%>phMs})u&g$ȵ·xt یr>t;ɤSȰzAƇzɤ#FBɟx>T!4@vm a>|OYqO<MDtnK1! ]V%lV*!DkF"VP7O Uv=18U))\'/OFwf)G0Au;$>n%!ʹ12ldxs5(|f‘lY*bpH AI3k$T\%vq#J!cV+HTu9c r*Ag pI@fH \dW/ )94>bUqݜ&äB,aZTdkdB273DL/ʡZ4bLG6AJ =/\s4@(IL~,4O)͍(P@NROEHUv:v)ati j HN0L$?=(Sxbt< if)l ¶Ϋr$T;6d`L"+($Aӭg AyK!H$3q ֍V L9R+`nT̃M 0(j5? !)ID$(Gh/~,NNKATF 258vJe*?d; !c\/…S)'zk%Pyz慒N]ģ̰9dLut, ̨JQ~Y(^' ҨQh?ZJ"!IDu8=*Y(!^14,p$ov|#5v& ME I M4,1H[kљ:Ѳp_>gD"F¸@-D;R(] !j<'T(HQ-}uREN/W /ϕ0(V9mh"LY'\NSe򶦃aq<=օi͜zUܜnm‰ -`\ldLx԰P0Ac+b#:`BE3f'ĥ6HTGxr$' 4X>TcP܀|:PXXKP#NH2I|^Tx PL#Q HK &UuLIƊ@+x*̈<9T[rNIaATH+3#D?:lƐAu#!1sthd$e-#H'K!1JB ȋmP HB&@4@'JK`P}&#jb#ʅK} eQ\+IEn`;UO(Kcs Ow>'`m'R5A.aEB6f.LNMY[XHgvl2cCHE%EdIo/b %'CZxT䂛و JN,ITL$GDaфNR*ܵrD뭯o* pX:zq du3hBFob焚,$ul("&H<$3?*6e3 lsʯyg^V!qANI 6ʬ$ht"4N7/c:'CJ80$F-F^e0&F|"dr&}")'e\o Ď3T؜ xr#t,dJ`, Hou0/)DQR6~ZoE/xBiE:8'gL3yS\Hw%(Af2f;daJVTI#(ݼ. OMU$(U%{WW߿A8auOJBb4+HuǰzNhT<]XX "GzQ֫iGJʍlK֪h"%f >?:L$sA/mASI:~F"Bt(ƂdC) I ;QA|nhy˒H3^Y HAΡ9@H1yhCVVUtA6ZMoƥtl6K Q B3)$3R<:d"V :ƞ,#/jI@Q`$Ij:GDdFSOgF/d8y+DxF3Io* Ά:TdCla6lMҍZ^E L }),,.HRݎ{G-Q [jlQp֋aM 䴗1nz$F .s]D P\CЈN}dAx\"}ܠu 2^|9T @T:Ə:0u@pILTSD[qc m##N=xTn`ҥ=. Ai9e_P*!Nb/tnHn Z? N`i6Fy;7$;SX =Ԡ\E1oކ;o݉PhhF܁'Z80ӔA$GzƀD/+t߇2Bg"idwM$MyYRH&²3b tM-oGȝ* @"{xOm@+RYHLyDOefG;#S`6ևo%jJ}k(θx)AJ ē^HEL:{$)y̞7 x2h3 Po?w6pI*_|5XTch ]:_`gT2NPNcHy [P,(7mMZx$CyVʋh`Ƃȏ(wP3GIcɹwݴxSuA5úe *EGu,ɋr*w!oXY6@{í r!: 9xejFEyPxe{dB2Gx^p;)'Gx æ;6&p"Bwl\b ozs=ҝxP)Zc{qY 3(|/Gբ,zW0Eu2C/u Ckᔡ'0 ¤0 4V)zXд#.}q#SHq;6.dӅ|Rwm2D%[KǏEcoG1Sɸ:kIݰCڭ8Za& &:O{2"BT)%$Z MO Us*u*ikrjn 8:V–" DM,mHsbxfzpMINtAH$ZzJ#+qRlUisyӨ_DGN!D-D X?: U $=A3` Gbc+>`~IBx#HU L;BLJVjBce7ׅ;e [Sc 꾔n*ܹ1b*=@ ObS+} Xkd?>m#R^$ E: ~&ݼ#M OV="l%++iX@\b8xշ@+7*)I&"#'$)H L.c:+[q:i:|%lع8tY&KFcv& h>|?2QC)mI@edTS3~`bI"ewe$:>Tm *6Ndsɛ]u*5\=dPP:MIA,6ad R#.(kk0 )sȗD핅;v:HI6FOG)Ygwe,6 nA~UG%q 2;;F{O1֯x"j^`wp[DT}(e @-AmFNOJHD|ZĺT@ZL[En5+^΃2IR%[ASe&cx5g*8O΃H{!, ;bn4R6S!IOjƷem[l4:xf1m tҭ_⠉Κ09Pib9•,7b1 7"P%aJrSfӡ~U1l$#OqڳHԌlT8  4[¢Vp}=:3Fa2 DT gZGgbs?ae$46o[Qh[y}ntvN]G>t`r:fRm?GUAFq(q/Sp5hL M_BP:(2s5rf9\8&ƒDi tIZ`c"&(r"spDPOHrd^9B.(g2 Wlm#_ +poH oIS 󢝁bGKAC γ%i*@%Zrj- >0Dz"vEqY9qNBq]yq"DcHKZ:@/mm9m &װ \QYkԒ'dbl#)y8%=. ZH-(Ω`8AHՁt9!$ O:ppeN.Vtxp$^7ҙo.qOvzւc -U'f^n$ .Zm8]Nt'(M0]!ԬtdzĄk]Z@ qTj=X+0 <~ (\I 𚍑HZ 7&e#ڽ/lT DZ$N)SbUIؑHG9mGpؠ&qGJfTghJ@DҢ~8 6LҊmqA&G? Plm,8F,$6%:P"sDV js}fN(e]>E2N}`&T#$ 5l#A2%03а|S_CDc;dl`Sbx>urV_D]A&&-P!tVFg$֢RY@L k6n aɱ{ >BUB`]ٺ5+(+&J3 H5N~S1 Bu'(D^4Yv!Bo uFM< S-QI֥R q%? nG0f9Pe3qYͤN_JR m=*V Ρ*|![L/gL(͑4zRTO>슧fC`IQF`s |Vø,V +1xA0=$A BH}H; U15Q8MÙ ̩7 AL*Iy* 4 10 *UR}`XICjD@ȬI,Mq{7Cv*).UHΎ D6ڒ Y#zM5!um uAt*JU^,uTQ^vMmi=iԔ!gDv$\=miSIJ5rv(h-Ϊc;,<ZW'æSsB8Sb|&j1e*2VV5\c;$@JlNnS),IP1,Dip }|M%VqP0s(@ >Fno!">zuտFJniI*#i3'd".nutN޼:R2FiSE%DwmP2>ѕbx:Q2@lhkQOb3fEAvoPDV&[*T2DlΚ,OI=`&$xt֪' /RmEifL -w"s,qOrw[/{j;PcHEk}&u}+0(H$*uْT7S9ROyAvjGNbs&Qao(2'|20 ?@|Q9!;ఠFSh0O>SI!ַ3[23y?`HWtoHJJiCYHhg$`Oàw'9&` Mî ލ`ӻz~4ϳ&_޷ QEp5Q^w쐜@ GZzTgH/%N:jHW2FS,h~]w{)SPx2}2w%HI)$EGbRIĎTs7g*; y-%" 5* K _㯤%-{TGPS.}I Z+ [RPRM)M@xJ x'zƚXJft9ҋȽG1[ʼnĐx)ކ RD`EƵ)K54A_}:L{^(E=ؗ6,`XKCqWU6IF):B7^/CImQR#R$f?@kQQԨ jLz&M3~J'69}+*V[enƫMĎ?4TJ+0l+! /؍+E}ɘ}O¢GxZ3ݿ#QWe8L  uR|_v JJD7Ҏu:3m&6KMtD)6THXƵ$n*BnN,+HM j8bBd 7D蚗a a3ndyRQъebqbc”''zuR6'N|Q7BBgSRz9ciKdA6 1m)1$ALkJqEFM5 B@-֬_>qÐзBĤAz,V Xi7Bm?R[؅R-΢LݼiAm%"׼GZZDiQ2v< HpyDV%d+N#Ί#s7̮*g yGKص(D8^Sa;B/niowEdp7M(*Zi%b,5UnFaΔe:D=Gx3kғڕLɛ;0*${9Mr#VgJ18qNBe2h>tR˪̳&83NlDլ!iJs 4@wB\QDNtH-ԩ'Mkˏ-:w8Sѻvp X>ƛض IT wJX9ApGG(,ɃOQ=O:("B-[Q୦N+'*@G`D_0) "bR AD@+lqR]L  VJ^L]AD{ $kStUAݧѵAs IQ&dhm87\LmƖINґµkk1텔{h4V bDDSj*FW %ཟ8nT) !{w7`+H˨B 5p!idQF:TsLEvb(~#؝ʽg t4}p ?'t: 䃨8uKwC܄: XB;w*\x֢;C7}{vd~?͢ݥSgrMwgN^>~'iQY;J~? n@ 4AP4 F供'{M K۵kD?2ien;a@P0y)vV!UTȟ:G$Dek9$~̻fX4xiJ1K|ie+eV" Lkϧ,F!k TAB;TV㽍aJXBRewj:m.+<(,n&`N6Ӹxd%*qz6%'k9XV8S9T{5"n4h'dlV*J`(mb[3S1P:㝭Ɏ 6Gxm5PΜkc{  Rr 8 3nZL* MU^A 5+`M a"DE/0k:PańF8D˭@{q(jb:TgAm!؂&|xxQyK,6( o%hdHgRf`<|hQ/ߤ)>Dk:Sr ye|L DRbTr<#[Kd@"[ݝsbtƢM N|5Wu.J&. fͧx8iGM5$%'82*U8 F-:ƒDJ.+9^ߙ1PH"`܊듫ǩ@Re@]#MD7UV\xxUeuKP9DDS&+k (&I*LSZEnۿȎ * }h䇳b:AJ:M)Z`1+h|qΉ= 7u$ГQ'}5<)Z.U!  443gp <%/* gOR,N)79I,q&tDSf3']j+Lho: ~'΢Acx(lm "hC'ny"D]Ԙ*@O 6|(M.TFkqg=Sf"d:hi FV0Fat$BnxZ'ERXx7~4H*|AkEP@Ye*/JNlʞᒴW`,2%P qڶG& Y {4H62Uf=ZBұ\tQjW7x}”Y3 kżO)/c$B;=tekm?I0$ bzG: Υ"֟[s$#[$$$Z(%ŁIT;LZ;ݙ'dzPY66}"CjR<:2$dfi4Q;'q Q̟]i)[=&}i_hV6 : 7&ܦdw )D^SZt0N_2@xﳌ[` 6)$ ]/+=JM4G>ͱ=@0-Lާ"GQUu%1 /qq!0 Z`t׍/"퍹.3ݻSlAJ`Xͬx~x*It:?:sIm#:OEݳyGx#H9džb[k%A@2shgt"QI>h;,%)B Dg`! }7cgLUNVT߈ܖÉuiUwRGL DHHp{8*aXN9a &Kׇ ;6}H*3`~4˴ { s1@ܓ3&~|87v;{˘5+H6>t#pqXL^Bcn3ZD8=,~`t~cp-jN! &)[yjoC;KB5\D$2'NT;Vb@˓I /DUg$d )GbH7Ee"Skőchkҍ溺>xV),*[ScƧM$iC  uďcjKf|hw /-:~;| ާ}Cs1$BY\u&/ҏ{*B꣗*#yBͮ4z^zhb ibX )mb֟O wS')TXvxn#^`Z:T Gn#W5RSww^`%:d_ֽCp?VzҶ:0/W-6Ŵ TUX%at8,1 DwU:-^qIBe\oʅT0`M$ QAvb֛$0c6##r 'KS"8}鱑  OJ"!= 'Qƻ>t@8ӇJ+QHy#=Ռ c(1É 65@&ywz+q:woMJ IVsXΥ)%1ݸϏ@^R 0,= 4Jp?cٸ1Ci6=vv2C-0@"` V *4&DHGQ"S:.-KV:i`GhDh7g264.-rQI.}Q6fk'@FMs6IndEe AV)QLf1 Xtq)b6"s@P9aZ$@ j)B4tҡ-\8PA~]FL\Vǖ^mEE'iF[!Ɯ? f*[ -[-3o%ϬEu/T+LP1)U,o*k^Yr r{ً !!AB$Hk y͆NnCu^TSO G?ۺoʎG%~L}R:_"=d<2/G^Er,ZʠzZ)^DݗJTGuSxWY6#㗋d1"&(n l~ʴSK[7mBq_A^ihJv~R^SNx}pG^ho^UOSwԚ_؏0 FEhGzŊwvq 1ع#N{cu1 &N/|؎&BPcn.cTc;K%9r8x#G dn!=hu_Pi섻8T6{u,)A䏨T[A$Fwg6}Fͬ=4֏xAu{i`Z;CGzEG5S# i{T{|){#wk2`BU?*&<7;&YOޯQT%%o yb2<(/vďgQkӀ(&q[-9;M,v!$\Pbjw#8Lx34;A7XlμN$ůu)kaާ}hlJWѷn>=B}S@ŧv Il6R9K+hc8}ÙM t<ڛ\x&-yfCK +[J!șmvAiTCC?LCڌD M#>; aM% (iN$pcx K-Y"I<ZJ{7AٛM8{DG!\ƝģT +T2vHgوL 169@1"FGČ0 )$O@{>'PZx\^SEϙy#@qR'!TdQ)`Lw{sQ`%$Z"|laKSz δJZ(KO$mA(Yˠ?ʩϑ@ ґndi~1A6˜W?.~h:,V7yA MJ.\؝¨$i‹'e4 |ϬD2#$$l$ uBC+e^QxdMh7'$IWCy[󃋹_G@4Y .{B~ҺZGU,xSQx;QϳUD~?ɓB[W1C؝:`֑%`+S'x0i3 ϗ{xI}gO:hIW:֧N{V3=pt",ahB F_==p֧N _<ͻIS'z5l[dh~DP⽡ʗ!?;<ߴLm+5wB-B@Aq"w=`?5;Z}?;%~0gJ1C5OcU+ևq sqȨZQ$N pz.`6}/Ƨq kG/pڇLDYGz!S$7x}h}_PX$Mhe{Q<#S{ď+|pKWL/q!t rN^!0 h%gX% o}ptk_;Zw}pHrBJmhq1hWS\жu~UQd.>ѤJ=̽# @1*̽ ^aÂKD n/rօa 8'PO =&MN @f>t{.:EkXߡ5#zpnBv;7i7HZM4;Bo ^DΟ~C&%0M w IZ>R<Ou#<: ?X5!FȐ>iMIFd<?.GQX#V.cDƚh6?0cLji~K%&zGK%F-+T\jS rD~t~B>b";!?;HW/Q_6 qw ˈp& JרiHIÒlz%rC $H0IH:oF( @𣩂/٢ʢ%wb4[Dq?ML1"# 9iEIR6 lL}NuPiCn.j9;D=oԚPl,:uiC[x{&q[Tc_G~҄E,M͈y_4!nÛFZIN}Jm#zn^ЎBgFR< Ct#qeYC@5P?Z=AŻ!{{zC L#)0@qY亇Cܬ*bWMK9FC ӾΧ"whh>22".<:Ҽ=ECHT)C ruI deKWyy{%D :f+}9@8QG=E^ahT+ܺUX'1%6si NeZN`REˬ1sR*ԍ-0qFNd['f?~\bFwjJ9EMX: BuJЅf.bY0|)=&1+ҡ3WM++։ -í-‚J7勭i;+g1"MZ 8cϢw,ʷ'k};Go hw'xì{X{u^WÑȝw DgC{4wۜʧq"wuՆw,Na#ʏrɭ͆QևtɭN8ݰjNem? mV|3¦DFa:†YHc6uxiȪs5#AAnh)րJM!~Ƶ ɵ UalT#SLKBLzUz[^^)'St jbtzU'*`۫ۋȋ"`$&A:OoǍEnglNl!2T'$" cr|)&,Ch&dI}N^}kWє6DZaֽSxu ]<͡ՓZ7ݤ@F9/C|p ؃tF^,¦ѡ 8Qxe/Aza[7eֽ@¶sMՃ^eoK!a@!0>==dֽ C}Z@a[~9{nʅHe^mSVO٩?VN.?aݡwfz!CPщ'xlV4?V hw?v*~ww`a[hl꺡_ꂔvŎh~Џ2@C:[߫{~Sh~wmolQG /;bK{%'^oOovcY?yx{Elcٽ{ac0;*:ţ,ذ^7'x%>D[߭~݃WppA-ZD\f3MOd!LRA'5ohe 6H? >TGB*dGAM2*_VjGRIP7OEآٺ[>iױo[٫ bEu?O1F+Vi^Ҟ2 -~tf^(wcV[#X}^_bGeBQ*Yhv3&Nn.802U7iG2H=YN=hVI/3Yގ)бڲDƇчcn%A 0n61*ij'I\3ŘK% k@4S%?QV%Ւg݈x?bFJ~h> Rq,:aJьԉʡX8&IsPAQ:fʘ&n??QN?1؄!*>qNԐnZ"-9IZ GABJqHLd@.c魙V4K:^cS{Y׆oJ ⒟ceqT`Q܏Ǝ&s }56GPS$qI2uT4_-'!C6N=GoI1HHʹL0DIy*RRN0EQ$(9Rm~PԎj1L$߄ɷ5' 6ӋDcJ6F1.AsVGIw$vu\QW@߹y`u:kJ԰81TJH_A$̎jd+e8q=x+(W]<1R

p)N9!GU ȥKPHl̞oF߹F08F-9A JTA6&IPiH)iJR@ eU:i:tW$L8' Ō0sQ-oi@ ,8s?}FF%8WGK*%Sb\1q өA?rb1t)zi) ~NQV^ZǜZ4T :֥hI&C#_!:_hb$dW|B-!3q}-Ҿ2il4 ϥ(ÁjQmn1FȐ<(݁*CdK7Ŧ܈KAW Tg Q6+GL4:7GY^+P l4(@%yu҉88raqkjj ġ7-#-Pgʥq*4hH f*qFbL"EǤߥ gIMiAcۅf;Eb3ҽ bӴlFe[鮕4BX3rZ: *BѴFX#h^ fCu~tнo_@E$NJ(o!``΂ƽ?x:JG-;ωi] <(wk˛ӉX3ΓG肤QüyO,|(wQxQ2:ACu1cGU3c-/sA3A .&`ᦕ[>бi}ҧq{;ؠ2 8";[ߴI7_A:P"l~N`ZkGF)ie(D;1n{EH{@S,LN/clHPjw&NBZx1NdNt`Cr5 ÄNApu1Q,2"P*X6$p>b㽖N=!bPI"urKL[EZӛ@9Pf~򏖺W+6wh]hҏVM|VJn) njY| !չshr,1Bٌ):Z$n*ٛ( +4u`vZ/ Z쭖}OhƦvVI$J,J#su0l3(7)9DȂ(c'*dY:cJ<ÝP1}gj6 X$y<Ÿn0%(*j7U?!{=e7QİwHA|@)qbu6v!G9J7Ƈ;ħKOyILNk ԯO4ha|j.!O?À{3tKtg_籟{^TL!{v69vdN?gt MBއ$NVas*~"A,RI+d(`ƹMH=:ͻA"8EH{ s)? #x1O};wNTMO؝VaHݡ3P#ξcC1)A_Tό}CݡrpP|s+ύN^7' DΛ;);M+ԝ'RG;[ȁ wv\10RTw'v+sDG%ȝ#/sA6Wj=8Ù*m;pn{?;8b HTDݢ3ۦs@^.hV$-[ʒ;֩}Fݶ'y_^7g>2fɍY/v#spOg?^B:aۈ@}IE'}/Q$/a@\@8 KW\ Xpm&|o´%Zٮ-ς7&Qk"LM::2ϩ[U*lHL]:'>W&%"'cseַbQ  o:jIWT^#cWڄ݃X{i78LWA$(Iy kex:yVL5MHLJBҾ J,"{q5{0"ukRܦ{l b FbfMo[qSui~#E+ !'u3s;DzzUӶQ̡&8אTbǨyʌkbǹ)S&@G :U#C8l" L5nK;R !zMXek$(Tg9S'rpR_4lnFw(GW8ue=G٩BbpGT4!0Y$#i!q>\mH=MH=)W?xK߰hh;4 wH|ÀFahOG$N]{I>sA;jqsSaQ)gwdrL"ZᔐYMfHN8qr\7y N +ٶs8 SZ`9 N_aG5RGG'tW|e>2wHug!ǀhܡv 8݊H2꿴vSo2wHs -%DvEv;!h, L }*~!{yfTJ:GiG,#1ՕN8&қ[;IGQfuK't57*umD>;:w:jS !"VҾX mLzQ]DbևN k"n%Qp!2]P`Fʢ/gm6 Q]GЙ!+wG Θ iS,߳VήwQN`2{SŴ87: h$=N\j~(={5-&K-HV! 4.D{jܒ@YD&>*G{5{+=~h+gG'4#*W}W%`t 1ʇ⽃g$`?柄rqgn(Dhl@~+^^]h`Qiwg@|Oă}А?ݱo{9ĥ0;2S(ޛ^鍫p1N7%Dx/C1t-Ԫ:}Rt{\4{wR% 17;;&LgWOg`,Cxƶ2%C7P(铻7?/g7y>G6y[Ləy1׍v#s"!"AmZI(&8$Yp@<؋gs1 9xOJI |ROb}pn(۱\n/PbNb;%C^țKb= Lqx>{xs $vwT ;<ƹ4Bjt tÝe;.u";!*u]KRs&f7ƖCH ۍ4V*dَ{I/?*YSCw>{ zGY"wױGJ[TXTg;U\4.F`J)YlOZtOmyRtGlЌZ@3u1ǐ.%VsRmǍ:AFezLr[Nʁ1/&`S1{Z\lK&!9mQTKb{66yȘ̌sا^ ǩL3m 9Jƽ[T+-0L&D#EcYJ ڈaiǓA\Nb JG/wwl`%JϠ+44\ZZ0T'"QeHv8 O_ʬ= I+ig'%B@㦿JQ[K!a? ,bȢx7;=Y3+*b<@އ6J&81Ƣʜʜ CnL Γ$5n4]L HEVhng[tkLفʹS嚑^NW@$aځÁjә,JG!X6v ȽHl&臰Sfb(,?_O_a&I",8Zѐ&L6qRMu)&kya"bԔkldU*ʂN [2h$EɋC~TaƅIҡ׍Bleu5uT23ZT6}*֩XZ <?>%Ա$G_*(".'^qÇiJ(i?M[ tJ6cĚx:Բ.N/%B vApA*\6xACrjJu  cVJSMJ Xr iEPL!"T*RID!yAM(@JIB\M5H2s D%M[ (3&D 5(Wq@X zҌ5O%̋VBsi5? (V:N1AL+CyUc%1cH)PPEF`o ,:ۆBd(is}zt/i&!c^NTg\BZ⩿и}ڑy.ۡpmDQ{#k BBƢ b;@l X:P Ҙu. ,<=(Y(w.D1ƥZx( iq (nb JxJ3bEQ h(}j]uw>4w 4ZiM$ 6A@  s! DLރR/ !(asV^^KP/ne UB ǕYJqA8i]/rvmbe &*ˤ톛Mlԅ(fsTO+c*_}7q\Hr=kV,)JalHSfhS,یlür(dG*M_PFo!I 2u#(bǵ}^īU &}iXJ;y͜ u|jcRVRAXϣHwJ8{  ƒdC{%jHThdyսB9U{%Ӕ` -];7لՒo:H :NRB-Ɠu1)ힼ:[!c0o݁Ea}-FfBZ+JG9x®V$]lVJbIƛ?h΀JݹN!I}] /25a]aR*+Dofk[&f"$U KsF)$| L/U%^R?:=Lpi P&`_kWBoS!-|뗏CTb{1`FG.zQ7n՝b 7vHRa. #>+66pg{w/@ R@gֶLsOΘ Uf ot9KD 5W2O.ݞ 2IaIT&ϯ)o7lPq ƹX7HՋR\ 'tW2&xC&2ڃ4mFl(ffe+pǏ[ڸB)w-8|R&a({0eɒ1h+Mv3+D Lǧ)nsio![rCeRz$~[5R1rvm* !AP"G5e-f=G]f7FCSp# =:'/S\g:Qdo_ D4J>uyq-ƉfXj*1-%*ח\ONF[[ J2$NcO+s~}J =&)O9s53&i'g'boG<0E[4,<=6>aM3}i?9-Zc\YEUcd}Gk#"|  ħN=! q5'Iq1AnG9fBL: _HҖeRbXk}& IRY&@6E·PW Pvӥ-Ebdt kDdE`qRNs-Pu谩 0P.>̈eC4NÂ`DbJUhA✢uB6EJ9ҋ'x&,M1\lj"cj0I<\2tdյfE s!&dq@ZJ14I0@c`MBKM~UB4M#8haΡ &k=οʡRmjg(Q$ρ) ΃k/BSqÍ@ A0R3'҃*AF Fq4PIQ@)DZ0F_%1:k֭?T8ۏ ځ\:PT8tMof]JhB[@WY$1Dd Z59F\Yq]mEĩ&&AÝ+`e$)ex4t#'8I*«!Ԋ ia㦕!| OKI *'6gʏ,x@r5#È;׊A5j a̳vPcR$2o1'% zG+V̶e9/I/ezӗɷp3@O g'!)ȚIKj (J-+#)&yR]T,hd4IJC"- RB^UEuʙ OL#֡-чW{Uqҥq)" u1STL %PG80j$C) Ud€N{T bMGJP`*3 Z8T 0LʍMfQ7M857ؠz?j6V?xlT*LKcR+7lFb']+er`xaI**0㶙V[q)KDe1ª˒c?`BB ғ ceN`x,X@|-V⒒j;qn( 7ΪT>&ߖBVf'SB̋7!|{ڄF*t =MDƬ߀JrI9|046DPn^t(T*z9E1;gc7u&@[:m7XCgu 0H4q$E#IeL1ǖG{*ue{ɶ$et BV-G (tZbVVaҺܬv}y^o{ ܊п#U ;LHQujo,AFa~\* *)&O?0?XT0QkIA$+kQE)R;R 0'N<Ϗ.?-}"BKfoy^RaN?H`?vs6lּlbc?0ݷ1 MJ)pJ486ҕ1)Q%-"|NXpNvtUD|oÝM Z~L'{#6'ˁS&IG3s|( kºߵ)$VV&L«ɂkE6V ni)ǒAmi*|Q44ݟ ў r'f:M$uOS'1;|N/EU!]+L 6ih "d(RT}t2ARsMDPL,*mxp`ũsK P<MQ4RLHРׅK>T*nLDr7BQo5QqmHG_uRI^\)BX p M tx!Jxb(g $O 4 ҡ.(gXRP7h* s( 5!t /[L@]24:L &"VBN wҙ}=įJn@MɐuAD-1x  ضFz܍cH0t[J15?g POr3 wJԬWf86[;t\Z@_>е_\n>5 }_JOkaʉJ<(4hSaP(4h2vRs>X J7:Ρ"޼F$4c[iƠYQTP-1A\=xh L\"NIM54Q4s^2Y*P F|viP$AI3J1/Қ yCҠ^?i%meύ,h9z҄`!@"9ɢBHI\*j˯c6}O?gJa; xYӌh68k-ٱU9C-@H HNP;@R9*h _ёGXʑiG$@S!Gne~)t%*6ʄkωR﫥MBO!ƺ9[qҙ{-HM_tQN=ь/f4<ș\!{s@~B9xaq٨]iPfV)i/t4ueg6}Ci P.yհŖKA.e5_}Kהeaґ)2Au])SߡJC!׬Nz8_3Tfˣed#{P0;aUN٨ñGʴk7K|.0sֹٱWa>]%Iӻ6#CZ\oآJkDl'X0y8cxWaI`B Uˏ(R'@=\?,jmfYJL $Hv$jTX{3H?p[]rTbx{h*͐6wl-PH3:N+' ͉T~5sP5XBLOf/Һ=&Lܒw'z!?&rÝ>l:\ =NCp#;U !f 6u3Xy(:WYF5 U-W~kTa]z;a{Hr@ʊ/-sqdJ&9Z⴪+{lWOq/@ -S`+5i"ص{Qu(BLL!#O^gQ)kat^'NH@.x0?82S n#Zű>CSE> sIZ( qԤGuok aHuҭA%% +~윖e;6PRR%2EdMR}QӸ?:_EoY8{9PoS?û2FQMPJXT@?WٹaʶGvAl ]6K?W|V&8΢aFZ>E{gpO:A) 84KBMOΝ+ ٩@@Rb}jYeLfȑ " #qt}BS$[ ue'Ob)sDR }(60luҥm853@R~P rH:!I@>hF-hl,e9~~(>8RO/D8Ad6 #]$!-ƉUnT2/oJ0#Ơ 3D*ŖH(@v"CX')#-oG:Vse> T 7EF i8\4('ZY@dX*EP~oJx.EQJ8<1dZyޘŞd< B,T!'hPlhɕ O^P Dq[t*) RAhTuk m0m=q5>g֠FPT− DLQgYP[o9zG' 3k ?* &haI hf/[C: mOh'3 7N5NOܦ\"q 9̙妕y.@ dZdmb8Ɲj ؼAn=JhfW?ʺ1a@ݪ&j6tI'YrvB%JLrҲ=%)䰐$OJ)jb9ZA@iƁ={$foh5fs <U*3ݑ0E4Ӑ&ElΚ k0uOW#;{B^ljo[yJ2rS[Du=9U< syRIƼ:"9O_: gҢ!'Z(2 <BKf8 T@&B ߔPARJM*#~P#!shKh J]ׁ-Qa< A{ƠH\֔uB0Wx[ Ney RSR_O#PN3"R|$Q Tij 4Z8Q!&36tJ8 XȻhcK7[Ad|huRO-8!-e0Dx!A D2A:T ҝ(D6,9T!`AԮΠ ))+ ΁6kQ!?4#0YL_ yjAP'Po(ϧ I҈Ć!V1jCbe6I_,R*ckǭ" 0;/' ̵JP V(WISɽlPl|Ӓ*[2M$enI+$p3CR]vk2eGOZg%EqV-{xYi=d,mFIl oVV#v))*fyvYlCU3Y.&nј kҴbܪN˝ Hd&o= RT>6Z [[* x)/p k#ȯd}m6sS{kSū BRyF΃VLfccb~5H>>_CRR +.MEjkTh"Ԑ2.)p: DbU|Er oPJ(^uɓ)GK}fo"V9Kc+q66S]ǁ0D!lnmR>+9DCXG? M+!84/"=U ት6~`Q% ;ӆݨ3{ho[P% J@8Pgi݅\,RغmoηMے󹦳X&@ *dݚѿX$ݧ 2*OM(2A֌xLx޺lmC,,iaV+y8t%ࡈlR"A< Zȱ\2+[g|OwK%Qt`RdT혁 kY:SfcŻfDhqwg(j֜[4M7g`ZҔj$s; ;ʗbI)-I)P YLԶ3LYVU1U67)Z,$fl%D!}ڥBeK0LcûaSwF&ݑsGD- 0r;RՄ^Ve)HIxjdl3]os k{W XQ Qo^~du^~JyMe$ {UoNéTH bÉVĜ@ PWk]{D/t jtOR%!Ă`54Z4ADMٸmKI"yŪ2Rfd=5ťJΪ]B0M?Pwmht m|O?RwtKa7 my@}d@/$21m -L'[bu'𬽛[[1A[1`Ē71^n1P7/drhFYyE@ ˭QZsI6q*4 V4gצdJAUx Y 8F]/^ԃCV@IyQ vrh/$TB2ji:\MXD?/t@ptQ ڌd:T}!-&K% mHJ&cK d X1pi`8RGB4j v?,NNXYm@zS %UaΙg[҄Gm "ǂF@!XiAQ=ihjY(h*^o8h - m7,ȒD?U))|"sP.& 5:kыOt 7׏/:e-,#Zd$e@ ̯x|t#V@yC?  ,*~2Mu,4A* ڀE3N@)+ GOƠ ^ÕKA ?59 7E>\jB٘'{PD>T܄}27 + C, `@3oVQPmmxSo¡: hqOqҙ*:]6ydpҠ;IE(9RTGj1QμhQ\։\&q*RGB ې P 9hA"`oJbQ*8LzT 2pA%Ȁh}zsp"4NQA-ӇB "-΃!Z$u b -%O.8kA(JyJ-P@e0u5Wm\Q #Æ(]-F-ĪNiAiF{(ߟ GߙAP!YL~U8TlgJZ;Ml`!Ը :$VMB ҡPd_Y*a&uEYmR'`  6¢J%xQXfL Pqh61?֠O ^ecy %D HaE٥*m3nVa\5Rh5g=7 ӞS\ջ_< NGhRW} nL^ynx~uL:uԅ%Ya=iΣvU;u427ӥ:L9N0)P0x k=;^UJ}xXߺ,YWtTӞ5K$)! UrwA؄qu2L䝾q]Aʑk^/)%o4uA [Y+`^^Ň$ L6)@T4~U\_E@y.F5kR6#iH"fuʜt5!-0ʤ׻o3[0ױDO @MvFnD pc NT-13iө #ttj5eo{ {w NU-$qzrөóۄ:~*NxէT}yE +ΧM|٩gʹѴ\ lH]hE[h{1V?f\I|nPU7ShD虺Nf!JY%Y ~V]4y+ӹj'0šQ_&IXʗ6mD#MR8L$QD+aQ!R(p$ I qkBo|3:J)y%NL:YwpeDt+5ͤhf!2D 6Z%ZWQpd1%M*tYߊ%ПF7{Iu-{S)Fp罟 :p A=Iksإ[c\v޲}9x13n#Vލ ä%)Dg*Qi[ JJI$Zua ;2ڭ9F><Ůd0V4{6w MRCt1'p1kfn~AtGԚD}?OD:n2Op>zD}Iݳ|cc^:;@qp$D}C'ǎ{C<6 3G%&oQvC:= ΧP,lۓMj'IG43n-IIԚ.=R=jwtn>(6f15;C74@} q"c$OƊ{q;r-yRGG6pn1dX}t7/OLɏ>'˩Pyyrgs$YY+g?y?/3 Z7""cnn6)7('F=0ƃlK{Gdu?wlV'u,#R;n$q4ΤWT4TWwQWɪD̓(c "tWZe≢3ճ(t}c[3h$ǧ#Z0׳p} I&-bI/@b{8{ өh<+$m0xtZ|֥Ǫ{] 13SȓMٹfl'b5''ЋM۝nt?ΪD(&ϘY 9xT@e8":T{ -Z5Y@\F0=iBJÐL1ۺ [2?d0*Q"~"W~%cp$u7ffQjVH4Az^SJh MmG7AnMqLQF4pчrFsSC¡ tD4AC^V(@z޳PcdRew3[I.A-k0W V׏JُQ--wiZCY;J %4L H)Y9/ Ox+B =)o tc\"PǍrbU+6B ]&"d7qA1ݘ:'ޝ <@8""U&97'(؎0#kJܣ7Od$~~T0h#p7l{@Xs#kdw 5 ';1W:#@0QI=ho `6hVX$sC&,u)T!HpP ʠ # (@l8sTARs\;,ڂ srqwP#iE3B-*JGPahQKhJxEB Z8fM))BA+c19@x4H:R;Mdu@' &['N4{PZ$T !8&AӅJ;&ơ4f׹58jzT =/B P'MjQ)B ҠO)dw( R8FP\Ή-‘1A+%B8Td^  !֥Û@FB7 n|hukoZ)1U,($GJ I<,&|h`CP h(u ϥ@pfIoߍ(xz`Pa!ROSzytB!tK㨨AKڈ ;0o08c2m@HAb7C.)7F_T )&N8LʈA&$3Ja;Gm (czcl[ i;A۳F N 2 "c3J0A7#O޵blc{ _!g6su;*,F#n+3?[ԵU\?k.MN ^XҺN^*3V' ORqȵMڼL`5=fNzvB%cuW9˾8[-9չWfi"N,.EY0g|d{{Jd0"=uǥhɅKu\g\n~!"R{ 0+$.H_@onq<: |;$c,<<:WX-li?y| Whvf3;n>DjŢ* _Bqͮ#HBHW[O+P` m ?21>QdlbvTL+!*d0jv] &avT0 m/*CnW g5?4>Hw_&0n%l]=rM؞!l6s"<񠻿bx(e.D` ݵО!KgR$2X܅8#MXԅ4wAV'OEJa)Ioxp%1ڄCH4nJڧ⧃؛w28~t~zlrspPߝ#pCxJgJ 7N=#ԋ8LHuYq 03 ~ԟB/)q7 7ijHy$G/W66ֲqB3*Y*Ϋ$a)$!Tɠ0qixA=_, GɊ8{lχ*&B7[mw4'yS g*ǃ,B4€?« @q0R:jɐA+ =orғ)1"/7A >QN `F)BГxHcR<Q2I[(! ʀYKK"!Dn հ['ёj r9kDfյ vQ~Խƍ-!SRbܣJ# 0®J;l P-Q[J@[p-oz s{K5 Sc8W-<R~ˈ!I\(HPh<(VìkU_U. b>\rڒԌ+f+ ;e4$4D5" A7L=+,2v4JuAFj7_a+c2D=L7l%I8x9LG:ӃEY%вdà}jb| ;%&AOG]I4ӲBH60LZv9ҬͬăZ-U[?e2q`fRՕI[:!F}l@VIa6mG ̛hq{xpj\. ƥĖsY*]8r6;#p1OKܲjR( 5tџJ2\^H'ҹr/|@y/'Q]=;QVhS*O.*;fSGA\YGh~5P(>Q mS)d:  |V!>l% #)u%$"xq_9͌(Uq? sٶ-wqIH- 1&iW&7Ѷ0~uv-,mV_ c_ZՏ+<͇喜MI II:ּMT'f9=T. ,~-\>) sOa$-$Qox_N=( QiU%e#0lmOH5.ElkiI90lAE_. -VFmU/6Vo w f_)^%j6zQiDN`)3K4(8ģ غS>D oo!E" b\o m"Co_,Bm= 9dkU=_7(ƌ:%!LfPsbf:U;X[#m U'iL~,q8b Xb{g^\=)k ^'R21LM] _Bv7b?{*@P*R{R+i#5.i2ʳ)%_!dllm}@zag Yh $mɈto'C_Kc [P rdmb)[9Q`S Hʢ[/qg֫Qnмf]QRP~ ZgÕ 6~6EIHm 51 ʊ]Bol2JekJB kR^5JU J _W0hN6#q 9̀>&_TB3+;.␛} cƬJdSM%. vJ@er֪^'T7,B[!G*ZxțYV1*P s"hFi ga&65v_2<3ߛ٨Əh^1ijEƕȣ`?;DQZqepCP۴˩QA2Oc[ed|XV{ ,= {ŽKHj4CŒZD łbyi@f}- $ `գ)Z.ujݝYp"lyV_TæC)$ҹ&CM׺uńZ¬BB ؄_Zn@%mfޅIjmAVP"yuA̶ӝ9g&nV ø|  (XVzqδGB g07@ DG:aN(R(7HP I3 Jbdڔ$IM2 ^ xrħ0<jU҄ah'/-iFJ i#D@?t?)HR2&a\rv VPR?1\n!zhG:yMs%* kʡ }oEȐAHwo@ V'_fV|pgq%wdt+L)['m-"{Ɩ2v;-r jy\&iHэJ CyO vB=$-<4^Nt6n#s-DHkzFv v>:V=2"l%9ΫKhVSoy0IQ3`32sO)xi`tW5[_g!q|yz駪䨎^n.>~e=Kak@ KjCJ.;X&*Oq_:׌~/18֓ة;KNm=NQ;C! `CU}n%nΔ̇i2y 0{ΒK̂$d/<ҡ:M22{+k:M @= E $,AU~FRMXLx0G}5ǼϗҜz@0?,kdѾ2]2bCJ8t&} Q'SNX> T!ߡD&iPkvg:DtH- f NO -hDCt=6PjQYD_а2,(+/I-P8CPl*5iYl^T BP/5,""Dac4 &N:@h2 T1=(8T*ɼ^,H#X&5` C:G╘(I\ iB'XDl8S,KL*fX{"DDC:ߍ6-B 'zi}Lvnٮn>|BJNC"ACO)GB{ԯ Fc$~쟱3Ms57ūf.eQ>K b'ڳvWn.v U2Ɏcb1IXKНt1b[P)H&ӤU{>&#iずkz oՋ+Ni}TT.MҲr^GX`!ys$assʞ*zw:I1' i1bmlG| $"">І%@"l8ʶ!JDޝxE@$ #|5gC>eᬯW_r-;K Ónm#X/~T8Z#:PZ(`6 ƴ$k@RD$}K¡{ GqD)DRRާSJPZ*Om2V C)^4P|e2ua6$qPryVA ģ,jH>@CqٌB Rԡ0xȨADxMΓ JвQB$HtDAjXIDN6=9@# s82'B%`(u-xޡ "M0Hd$q5?50<4RHE i3QrB1lKr@xp^mOoi{V>CJ誖#(*miN\@c1@v@AR3OʱF_J%w6Hb4[ɽ)-lϼ :iҭǏFV{$NsTt{>B^jŒap*Zh:Sؿ'{ 颻̢] LYpj{Ql[ƭ,~Z|v/iT/Kz['#"H1>"&;c*fki P%c)tnʒ-?[ً( P^UD&[pbJRAJD ¹ Nj6&?*ȿZ7U@*đ5x6))Za2THmCZ1p~Ri8MR60PDžt\T3ꭉ۷4$^WcAnXʞ* ׵Zq)>U]572eiRNkN w<>֢"ۋ@U|"bs:yfҝ2pe=Dg~T8pD-" <{n"l' sڨ9 ͈I.5d^bR 3pAuiCdfnY.rAz3K`v#j79W A±Tvv0Wf,ĉ.FnV~%-Z^XAQ$@˞G9VVUf%K%! y|Vۋ^,YFoꇜCL1u;ti Lxm5NppF۸ Zî(BP'BJK^FTml{U4;v#yS[p-AYM@IZnښ*H 5@5e~ꈸ[+BX W"!S"$O#d}Qe *.&=9ښoą YƷ1k %ֲr{/tbw@J]@aa\FhuX w2GڛŁƂێ Pb48rLHl\AV¤$$ ~G}o&olRRLGPfK8wZ:?mY7Qt%C\J'ǂkqk6Ho/̋Y ΄MB ?3~QuDPmOBBAʑ |M뵊bRvyPِ L5*hӘ\P*ANyJZ5hRmD&YP1K6֏wB[-w ħXnej$<OM9qh/@!)ʤf Z[mvD' æI<"*gfw܈8J5x|JtTl3[G܋방2&i>M﴾?XXO|[ob`:~5WX2.~R4>LQR3) )q>Wx1HQZI>g̞ T|5M4;d$.`kXbV*L:)Wڲ7֬!yd=2ϐ'e3- AZR 4:ssГm\t 'B 8 A3D ID~4,,=iu!p­xu2"݄/=,eY&z 2 "SN؁TB(9<|hAָҀOn'(V i4'^Z ]ȸ)`7( 0xPazzT ˋ#@#T AIaH'MD>(K \JE@Bh) &xP!)7#A;tߝB ilE~5t"<̈Ae$T!⼺\ $:R RPCg)X0@'z@% ^'4[ם0a!)ʀE{ ٙYYIҒ "ܨEIAS@#}O€GYo$i,/*PVYҥfQnޡ0PT1¡C}_\w)h&mˆ@uA\rO'4A*{TAPRTyiJAoQhWq@+d~\[OiY(q+cJ @.DơQ}FH23E^8T$)Y T\$h&G]-o`ZɊ$tǍ+ R Aʖ!VieϲMF1*>pk(_V,uҹ}m!|?d剘ΜYgG]k1(ԥXCY* } tRVQҭ!3tfuFL$FPs6u֠BfRLP =̴:hmD)$]D29U\ )@ʻsԖwR `ˊFKviJ$luj7jG tGd'0[> #Ҍ"D=ǀ+& G.?3+U'e#^d Irvj0%AKLr< ;N{W+"¬*VX+5xOr bʠLzvpُDt< kF2T1"~u6; ; _pĎUh>QFgNI<.It[oЅ# 2VmnItq`6! h 䖘TU^6'" M\Go {Kxkt&[4fʁeG ݥy0~u&=kHʙN-HT;U6XI@G@?FdHݛr]8o\oĩX{J>ؗW!#Q}d[  2.kGxLu4wFZc;,#B 'ԓ5LÄg{萜[>޿W_!ϊg5E] ٸ:Q [pJOKțr@ˁ`+Y@ ˧YLd"jCk&FB SʀN\T!DfP= P tPGP Ӆ ~6j -@@uP:!\I8uJ$ژFKΔ@paPIfDmDGgjEy){2" T XPD,sΘQ,OD4/ ˣ?p ŏ$#jl1"&I+O^>T< u .@g΀D P!+/BY"曍*pC9!xD۟ FCPPJmos"tPN7 ό!!c^()umPmx%S~u%=x '5TӘiϥF494G 9Eh[ A䱔mDT*$v֠A×Kž6H?/tBKb>TE<P9px./j" "T w:|jIRf4*@%#4*Z.)œ0hY42bbG֘Q䫉^UHmʙBD69B,tho >U(@?:aEH7__ J#6 ZCKL@$|Z{DZU#ʞ5ri[ as*9& Eaяpna^y]FP}y$gdwPH,ln[HljfYD:ۘt6T1&?1W香]Ek{9}m4r-\qKO()ē/JG^ X R pS "hPy)У{Y^4T\(ɕCn% Cg<^B+~88"Nı-R\d%^xkTx.lp\}CI?K;$: +0WIgY ʌ%&Ld\%/:VHL*ż?ib R2 "'ubRٙ_6[7N3 T 4ꀷxNs:̒*/ݡOi {^ p)wFm"$LE]ξ^VJi.썿{VvdތF p  JdKliIBom,L)BX4 'kmDc354ؖIjt ': ؚsum<ɘX pֳƢMʝGqj̹A[9gTk#$AI_U73I\yT:yT`nĘY L^C>s8qFexAfڌ@JI@}9pqMkڸF\kq\HkĘEBs 3ΡiEr&Q!B{ę(@g^lOZCt((Pl7WinBr6Eq2ƤѾ.wjȻCraE@Ae™Jՙnw!EhU'9&śVLnFc[S =$=G(]Mé O5 H)<"9^j)*|\WLy9 :VaX7eto=n+@+!&',ZAh=|N;@[eWUEA'tL&ثk²vc{~\kٰac?`?CZ;} r-'ֺtf4gm

1Ql0I #WFl $kx{CG%}IjpLx6aF&R~kMh(eBl'&q6fٕHُ rӸP[boʈ&F [ -+3:3&lH*Qs b B -ҁ'Qc?DAHIB(cSVXp ;p(Kfy1:v53KIFXYI :r=̾ Xe--gb^/*2͕/ҥSb;1B5>ubnXS#G䌱6֘tU>L V)ڀ9x^$"fM0_FII6*_${ËHĩPT=- 0MPŢ5V졪#! S=5&{5gBdfN- һ|őo#np1M kC/Mp)ډv&}jRPyMT5EP oj<MRZa?E[.{ƘQ~53AbNƟBYPx![! ʭf@J!RgQ§ sCݹZ0AZ"қAk(gB9{781̟O SVK<@V0(XP< 51LA+: (/"@d_ ģ8"4 W5I"]5G2|KAuJfNWoOґYꎣMp8E%N%6$O䗠1iO>4/TFD<8&TGCjY$ɱ~U1P93.܍]# %'Cyl[mF)e$$ I (NnNI ="WN ]"A,EyR<޽86qQc[pvωEۓSM;$\ a{^TK>*;Y$«clު1eYY-)01u+Vm(ԙadF9@"uXk/q;\m%Q%-BIxMބU$dRԼX1cs4JTP5))}-WCN ( 9\ gŜJ_a)P [C_+3n]lI @JRB54YLtbIb ,n9rT~v3b}dbR~,*@kt>KIʈ$XvbTC)(@*J{Å:2wpEnbv!zGjI?yeH3K0}AADPE1#P'ӭhSmGqxvHR{D'KMXx#TS%>w[J%!*BBRS h 9mUJ&8˘͵vA8hH$8v龶1IvBq$ F/D߹\ !A!<)K#Fqh!l*)%_#mEZ}V$)Žf/܏L'ݔ@-L03`1.&(RoA-KJ~$@2Z$n2 %]R#'*>uA_)?Qأ 3Jئ]g:QAqE@5jzv섫-(4k+ƺQ:p5Rθ̨{]iy8R{$F&WG.rVHe{<4iP^ëOuHP3YM0> p ~kvs,tZ("v/Է&8W)І \ނ!8m;CC*Lsv-cb^L{" <ʳgB=CAw+ha9-րJݠ9!Y)#ǫq`fB.V^Ю[RY<:Ѳ%@+Qe.re[e@w FerkVL ܪ0j2X J% :W;6lJX ` RfdDȆ-ӝ" Y80e~5HI:E~aF $]dQG=JНlhĂHta.,Q!COSʰgW$i-wiɲJ)#9.Cq2 p\i +1FtX&:Ց2r~5Џ7/*`yȁ@!ϳZV}Jɔ +4sb:r)|,HqJ Q*)rۥS ՔiqZ֪oM.t$&+F˹0mf)?h/pz/]l^Tb-E_ͼFƷ6R*&/\tG¡/SP1S} S6OƉ EҠ!ņ'S>~T+4z /[OL4)4P9|iUJZAD|VA $NXcQ .EJm{>@: )E5(rwB (hL@# f65(56,DNunA{" x?s%Ao7"Ev9ԫ -es)׭J $&H$ů@ T(^Ozݪm&ooG 0hiJj#IAM 5D-t1%{S ku(qiA..G $L~ m䢑x!{(H֡-|*k1:ڀO!3Ph(EG[A#֘ TdsPT$\ mƠId|4ң‰"=*_B .1P6J RbIʡ^H_L DcP'`&)H%2 C 8H̠BEQWL)CeC)<8T i…IC"tL+m9ok֘ ҡ,dLB;mcʀJ.Ҟ_OHI"G ]uxq 2d)6m\ҷ_OfwV h9ʬ쪛33f+WEvAs)Bg9JKBX*V^1'Pbɓn%=ᦾqr:( Tb-9yHT"t rkV^bJHu2L+ =!rϕcÎ|]7xم+Ĥ&#'lRMP"">d+rrKR݌FeY$ _*YP|Vh1Z|FD:\EM5th5#gJj׀![qiǑ˞S`+{5cIP/J8[<\]J4Z,qjrx=tN ]QI*<`Uy-ʊ#ňgk`)(gPgG.2jwib7d%RTTVHV)9PDRvZAZg `6R.H@2+cɲ(K(]O יE&X{0QJ$A5Wk[b䏵wyݧ@KY{@hb1 ^l=X9D8 T5Uq;%}!:L*`d@n,C/+nˉn/:5fX-+9vsvhyeĵ ZYQF#C_I_h%Lrb#KN}~B )kc3| 9>tFeHVwqNIׯg{ЖʻB-)Xؐ1Me'-TZCͨ$$A?cK (Q2Z-umyIF;yM) BJT $O^wF!Nʔ~RWd3zdu}nvXz}?1 ŶK@ٽ:D|iw136 & $~Yǯ/>`ң2Y 9XyV6<ҕD<0%b?Gxu74Q߿o JRZJRD.fO [~ِ\`8hlHP7"oX5+R.-cࠀUWQ_* |)s) U㺼V>F/V " SO+.!,l1$x&muk;]91t䭵%MMXԮI aG85[p<|^ ) J.er"Ni*>ف>.f TsEpA'_آ   $Dʹ!bQFwSd t'RA1l/YWf-DmiȍBtjxxUn[O}AHI'O,JC^Zp)leLk6ҕBD+$t@2E߅pAb$7@C~[K8p}'᧝kU7t7p x ˳Jݶ֠r浧yq5MFh"VI. E(fUƆWi{G8'[J:c(;k:a% $A&cl`Ӎ@A)h E 7$'[ EW!n|EmZXʆ7uci)5@Z4/V_}a}Q<|xye2o$-'L:%ܑWҊ$ ([ZJVaᱟ8μ!>h+ u4F('҃d0knMl(\0Gk;0}J']cJGɕ;T0b]ԉ +|׋ViNb`IxXyT 5Jf=yՑ&?Zβ7SD #dBVI b L`sKrE=h,1Mun-DOx$$iº’1y)6!!< O&IZ^2vWf6Vm`h7kxn\`.Į(7Lm'2tָ͠448QBdH:S74HFuSրFCYE@ [[RdpJ(I$Td(EaʀJ[%#(+YUKa/DV<[|y#njg"4;($7 P|F%4i$!_ 6>*ivvuǔH ӍDBAl/J:ҠODK ?By0 p'Z$# 1y8 2PРD*R C։flxrCH֠Db yPY^YLi֠?D'@@rcT&?~Qz pC*ʢ 7>t@%5x*Fq54`d*F_@x߅@ PIJH*BItPI@$ց@ZJ [$OB) \މ-kxGK%$3ӭ jm{1pTs;jOiHAE&A{E[x;: C>4F[jAA_Hm@ Rx0H@7Q$#5:P"Oz@oP=zAҥuJB T*?ˆ9  ,rBT%ZʚK)IH NI]<}AH I3m%jźc^ %6qEg*XLύt,C+Mͣ΍8o= d*8Vш2Rn y1b# t-OL˶JFR2>T±LakN1To6)+QdҺщ:dы?V= |)4 vN*I0A\'kiH}b))QO{Z"vmtDU1;Zy60&J`=kze ٿ0hjbR.DzV,Fd&AeV} 3hIe0jܲeV);~p8 S(xYhv~xU%x*HEtnpE+i*W6H,)NJߤ]˼NSd$STj ?cl+ѮηNzQJVh;+dd7DܩZy͜١*#;mZ`ƴ( RcئaU)91MOtR |#:tE\ĤsTIMr7 `.OF)0xP WR x^IiB!8P E%,!p,WW0[YkC&"Wcv;٢~u b|ڎ6$b?"yU_1k rЦVT A5Gfv>H4w{nE'j2n)Dfmd֏{E01l20A72kVO .+b'_,y$WX=Ͻٟ~5[L΢;m#\x(=yH~?ErHkWI[qυtWQؒR8DQ\.Bq3 @'RڂT)qVVI.D#r_AO^@~NtTNZ-KIַtb_bHJT(A%'{PUʹ#'Fsyȵ\ DT9Q T- -E$s?J0If'psHDU Tbpd{jpikTbnX`rˆ!Yn95ڣl7$ ߜW,46Vd FR8-Dy̪GIҜk[vQ$Dt*?upҬ9X0l:ƈru0mh-M 5>mcΥ?|;5B]Fqұ #ErH!KҽJJCj0(ֲQس+wp]M Iu5iD|f\NU4HZQYZ뺶P %$XCֺzVUfmZ] xQ ,<|ɍj'vv$9)1):PLj%`E#i|17Ry}ogF_wM Hr, 7|uX8|%{w\S. HˑIj%Z3qt81dgr\\]3jv{ZBDڠhP =HGy+j~E1@5&$h#CHQPҙ0n Z g x$Tj[9 ^pgm rAUpx!o{JgJPD$[ơDXrHC9<Oi$ɵ x H#^4@x$_ J$:64%Oi4Mj$FsJ(%D$|S x"GxLT 2D {J$8Q!}dT!7&h" -IAɠ1uH&I#DA՟٢. !3!BF^T<[ ;ڟ =@#]/ƈF)OZ8\  != /1hPE4JQj0&)%:|hq€BRU_ʈxA)XN'SPJaE635t,EB Ru ;k[a`%HWRAZ/2LZEz?Ckн@eȱΞfky_\2?KR.;Cݙr An7[$kyzš îBq Eh["L5qд@6W*Lސҝ h#`_mR !aҰ 6e+>֜>bL<6v$0lB@¿ s塩'SU4 E Uo{~3/a@(or&4_n~Seِ8Mg - |zvHtqDvöTg+&_3-BM3QT^/X0`Ɲkp_XDd]XMR2HNN1VGNYUн{%{ MҖs\1ba0 NxD-w\)[=Ҁ:֗mUb>70\"@$\""VmD(a[ ?pBP'7i!lql.Sxy,OK.϶f\ I z[Vi/^BvY_" QR/&_٦o'AX*Hq)?+)G .=7/c\JRS(!r#YMqW"iP.-S#=zUP]_GH(kVp.t*Ȼn~Kj w{T`њ@Q,jxe|꣔k[4gʺwO٬~8{D@WyM7i+=קa\7mlV f@7ӁG :?a{ų~$BPzSb/ *b-<|I Y6tҨubHSl}YpoY: x}Ϋ (aBГ}jZ>W &F?9֒c~[<^՚%dp,b^Y\kM&zK3'%`1¶G^vOC8Ip zxvӸ0PX% k USf6ءR@B %FI-^K'[4h')N59M)%)L8uh'9 'Hݝu9d!Kh*yQT[S$kH톼; ""G@m@*n9E;RzI{}6Cg, c<*btIc?ꋊ?~=xy!\o¾GYHuỶ^9=@*Қ<_ӧ f  XN1Т@71ʠ3NlIONv]~1dP-ѭmqizWpX}){&S):O~ 9¼ { 7bGmYG|{Oi ~U6F9 gEɋ#Q娭xrS)z{ nd.Qty'C5&-kJc=&qڧCWppܥe:Z}:t ؃qϽ nʪ Cy0Puķe'l:uO]IKB;ƒ'9++ bH]odY ɾ9֜9\2·Pf(YhAPs+_mCGoULk U 0$E8"Pr Xɔ;1ďV"fkWfMv0s[1a -(i~"fūut%V ?*lAp#j2$'%~r/Q2{!-b `ƶKyGl=@2څ+ɖH)VTp(7nr/4c{m;$.˰3oʱ5z)RyD"qs'qNf?C]su#dۘ@<?*ǘьѶ{9:&rFOb[&M2V(١G<汈M;*]@ vO{3żl=Lڬm+h[܇lwtpɼU~jvcqԂʔ"PEՒht ͔O 9!Ԉ*A:d<ڀE~@6 O40IJB"JA"4)y8~FZ]3}(i A3jQځ4h'CB&Pu3xˌΔ =GB{qAl0 B@LGqJ&)BBƠ@#%=IB~ L)!QcP^I70f(ioeP Nk҄q.8Q nf2(u/(w73PKo5,Zk8ɨA-ىơMB tCP;X0:eŞ>"THu ^)sEe@XH"@i 5ҐID@$~4@%dDOB" #ǭI7€I@vy@#+* mơphV@yȨAjN~PX@tDbyuQ'(Bg56f3JAJ^@EQ!вTLBJ@V{33cD'扏JB3 9#iP#XXK%@ߙD##ֈ '5ƾ4H>P (R@p|-DXPJȞb<VF>:Pn!$J 8 iPND" |ڸ4 2#ȱ*9y;9Wp&|-\_Kai@g>JnL):?*3Ь3c WM%LeyO%q{!f}L߈a9tTI&d#b8~tV9E+OOΝ a&~w2X|s RH1Ñ[bVPFi䭙/8isʫ5=RhwhLgU=#r+̨.sEj qڊ,v 5qftlklFx\Av2ePkFi9G?x]Tj; >?*9c JU Vآ~c0;]=k3/Qeޅւ#TGc"u1kSR8*T$wSW*ˠ8/xv{:*3Hvfy!0#JGY1ʛE[3;y'051έU*+v+iͰRnuQbӸܜ'h\\Y)uR|"@!$}<ÓL|ڸ@NN`R ;D!^Ul%^ͽ)GEڕboAÅB{QmmQ{ޔ=8H)+CN Qő$ Gї̊+v﹵]HLr:2(=.K}8IBl2xAGʲDg[1{ṅR$giQÛ_"P+,!)*Q ۉ=/ƶɨT6v5/>B4O DJMUS64ZcƠ)[&nkٱM q|hr\`6kxJ2 HJ(Eb=Բ;A}"*o/iˀVb b]OC)*Of( ŸIcJ?G7q89|INusEťݪR`f'Wl**G*7} ғ3s"@ F|^ܡ6@M8B MH&xũc}9 yèQ{GB&9q&= ]ȶ3L.,A VyAϩ?Z# ߍȼKm';N/-䨕ƞKTi[0~6e$EsOtc-9مE w)ucϰIlRI IDI5ӍmI.H`GxAx~Ir@kR)CmJ](bfIֶR(l.' م]W&Ǩ&Uҋز[I^WKJSPUuJoe{$$J~E1RVGȎ%F*1*->6^-HZ)P&LRI( #/b0E̩&unb8SFU"5 ^ģ ]FmcYeٗMVORq;xC &nSn©x㏖:QBe1nW'Xܹ!X Y0}4U)U)?yKاXr51pI!-un݁*DܳztG|IN14X$\,kWSV?@)>5xV薕HBRorL;֜dU%ħ*\r^1+ 4!X VEWDRm,6å^m^&յ,1a5g>"5v5nQi֣ wA{4ן'J<#*ޅyZ}jֻiJL|Y+hI2koE"$AqfpTA6#@CYn4! BKsl#6*WhfE:Wj3q0 zQHֈb ;ژԀoPd<{*3j i1)<cioPsXFB[BoQBr1҉WB^0@]ēҌ+b<*ӅѱI4@3_S6)qݏe6aZ%@,%P4ICJ_V+vK8%cT<JKR/%! JU'L¶ksaJ@5z5Xm-H "aαrNI.IױcHPGrRL`ВSWaV.5CfJl*7-g1P @BT8[ƌ}<6B;G CZ3%)r[4pPlNd>(  )k0:pǮ)}r;sA09MbJ;"!m;!JI=EVKz %뜕2( úְE`lNºȤ%DsBgI,ܩŤ+-O?xSvzvvf,z|<> @~xw(- '駅k%\J' oq #2dN88n7Vr !Isֻbh&+"Ǖ]Á* }2>ȯL²vnvBcHav_?.#O𠿃$~bd zVJ.H"TS b Z$^?^5Vll,/sG'/ 嚈 9R 9F6J '>ud,1'1ԓ!Ibd&21Ώ; f;LjR_p܂Hdo|({Ng^qvuiMvZQn&iW8oH@&MFS 3iqLl8*_lVD-* NqNjI1\kpSsV!< ӛU1-S\Ftg1;mB8Raցb/0r?T68 6~@w̳)Zx?u;:a+ 1Q?đ&\xb7xY*qNJ\h9oO!w  h2::V_">;g5X{7_#հ$mJTa8GkVLk*$ecK8HuV ,Er3Jܮkº`JS A z7XY@tmgܕ%8ש""k; Qj~&I)IOg_\OU)?׷ݜ;o i25.9_Y6# 0J#Qa~w();E&8ک+(֊-}raI h-$L(PEZߞ=ls !Y"IRqึKmh $Hnۍf&S&%څM( I wK 5I&;Jr A:Z~d7ؕ0? BBZjBmn)*9OvV/yДȕpZlBSxMdy/KtN2AjU $SLaҥ>xem)I|Bf?04PIAȕO}*u33]S RV2(@"::r]2W3)RI)SN<ϥcK٢آWy κ'קU?t=1n$dK8xJtA;d*,R3?tD1l;t %*C`s$=NcʠnɛeڼRJ#IcImq%դ) )%*$xryeFnB?Y˟`p#SZ@< 8TL$Boom^qr6t T6n IDhܭqeBT9^9*EX \Ӣ*4@`9ɒ;&0iep6)b7EMtTJT9UVe%<{A-Puzd1 T9ʰuc^ӛL~46D^>XCXh_Qo2 @uO$t R lՐ:֜ U wwa{aFD$]Q7:t2egl'sٲ<Oз X=ZMʊ?~h-_,tZRȍ8٨} uq8f`H+ҊwAOdGh ]k¾ {'LrS7l~cc-kټ{,J 7$usY@@/@O8XΠN2rBmBH??ҀBJ{@5yG01jA0@]*v0@$DDۇJWrDWgi=iHqd*CmFDlXPXLCgCL]iB M OΥmA5("B$B,ޘd=cj-R-h㙨CMA!!Čl4υqEZSx_JDhHhsPdNKց0ʉ&I;xAE(ah8@"`Fy aDDhRR@ APQ~t@ .Lpk@"\-*8`-DSV7@5qD[kA@#p<mͼ Zi PdqD@3$[ : v-4<%17A-ځb7AӓGDfʠHs>T͛xP JA3F-Lp$H4?SPNkP!;Po8EӅ@[sA.$:M@^8G %!@Ī(v/,IB)鯑Zq(3zifÚIpivW 8C_|YW"tf9{##<8-v>V%)6l kum­e bɼf-57ӏ`êP^W2\ѐN4t mp[,*dD!h/ߝl)#eqoh ( I<<)1A%l3(v=Id֯E.qٽCO IkFTLV?IBFRti3^1bP#׭`qfE~8 YMR+JpGV֔ʀZMӰjډpk U}"ۛurTT=؛urJIlAO`HPR'ƬS"m< Ld! "/ɱAb5"Ћd[gB!cfXrL6](#09`kt_hynO&R0[kO#di{}jo<}7!Lo!ː~6i@ѵ/݃qO}!d∰fi?O·Xbb4XP8݃- - 3㥌{}~$µ!Iq -pu*|?!Yj@WbQT q&b:KLM⽾ҟjJ LcM0>:Ja(*RI'Zr~H،zی BPb&ڔ|E{@M(Pi'D΅F531ʺ]zH2 B#u"dh1,a@#1 E,+$dhaV-B+F`):xK?@5eWR{qHxRUt[IjĀR~RF:uR!WƱm3fZAm_2-W'L:jS"ZUS@I=+?ïe-<%ttgkO)a٭ƛQ($,m1p>I;7~ǭ-XR<5\;K{j?lDX:|xز[kxڧTH!>_n5 \.;e{TH4U3w52 ̒[^ m2O*IIGqҳXobTTxs&W?\cE/bJ%$\ҩRhv wbRG9:SU#,tn;'.䮣DžeˇNNmҵ ^bHC?̗x|JVp,',\#[I rLyT_}H##jȋ˒ I+ a H ^=(]mYi/~'N%*AФbh1XHT 8vړh1 $\lI)q'ȏҹn6Cf8`/8Dd\iPW @JMD1^g<{EiMwqQϗ$Dڝg{;!H Arj*ٱ\Sp8~FiRҜ~lQ%7 E%  i? $:ih?*¡$y4@7h-A[))1ޡ4BɊ #J*HqMAV-J V:΢hڍl䕺&yձH Tة#/+CJʖD iY =4@a O  DwPwRȋ$5AE&5òdt7AdPF/ [p8OroƒI 87 Zs8|cR ]4SdGJ[%~]RCiVӧ[?72qE`Fd6.GG*9ꕖF4'!yRr0d:!F6*XhmdU?*6 ;|A24?PZ:Pa"W$gAC)JhPI "E@-4/5\r2:u5[?+g LCɝ w 0+<ӋlI-Xʗ Ñi3s78yU6UƳp"PZY@q \G5k^M4lY"ǭceaB'8ڕr=jH̶}Φ ؐfDș>F8_(h56P1Ҕ`{4׭W~gt#2Ͳļ]D8wwQΖ퓷5',~Oªcc֎3-óNmÑ 8$G ZC|TDը̋ xם@ BuĒAAwCȨAW(2aSx&x#(@"B˭ .5AM {umX`4`+P'$#ҡ~Qơ~:L…Y^ ` _:)Fe& (Y@(ֈoJ,+E;(O;Qꑕl$&n \uu2!\1Ug򍏐FUlb!CbxAˤ$Q DQ?xp4e*+VX0Jky_J1OwlY6Obsy˟ 'Æa %JDJfےi0!# :{vl¿'7*aݡ_rw)%{:*~lZ-ˉ X8mк1ǴI$r6b)C qMeD$GO﹖c6n#1'->'EX"Sn( 6'b7 d)fVb aY2ay% >\*Ga#">s4eaN4? N{U8{F Hκ5ҩPݻoihb%EHLXFŠ =[?ȯUpK2r]ldvL0$ ):c؟Je ܰXƛ%:yTa'e)Ʋt.[Qn9PL-+Q<$&jMJti8Of-# K|iuBA}|BA"!1\ġpGf&$ې/ηJ%|ʳ|bv24b:z-&ySajF=9aB@2"3%Ŏ5FF44Ϋ! RdhƻEA2] aY̬\sQ <\RTL65Ė`,ueLAZǀ(VRx@&N젌;7up2/:16A2 s3]yQϒIܦS'b'5?CUJ3Mo&I>)Qơ>=qj u@$xqMȢ)CzFcʧ$tXl6 [mYh[C޶d[8P :txThj0Cwb @g8H$<|wAF8PB HBB$G/ip|)B CQ8Փ{)eAҥxj٘=oo h4IJ+)Aw`uoXMfSE(qSWZ[_wѶ +/ Ϗ#Y(k/P}(Gv;{ ЛQ+$*onÔ/Ze4molwr5|iqYCQLw;F@AOzV-fLh%EĬV%Rr~ON|ܭ: XU )Y{[MrKm}=h-;J `JqZ Ii2NCF;檮*gDD1|Og”Ņ$ɶh1oA@!\- :ʔHZۏ9ԝ-ƇiHJKj u©b{qd_yXt: R{·'hP㨼lҊ\`Xh *c;e]YE\LsP%WXj=jktmZ!6MG9J{qQ)!D"3Iʙ;58<9쮢!) XWYTJdBK",]}yw)3"IКæ4t`H!kzhÄ+h6RrskIׇCt vI HI7 #)v{)hRӉ8BcTnԯt5}x݇Vc6O Djjod X∈'AVb9Z-o;wh@RxxGTd]Ըe* }כּR- AxTpOʩ+N<gjJ*R?ױ)"#ҩ?$=b_Gv1{:j CVa@]WK^ߒ Y+u̥jLzfUJ)%O63;PQ,aMc#@-ғ&;HO82l 0iQeAO:] &FƮ=O~Ub8T%$&tq7G3Co!8̷6%ArYrv\#)J)r8E>UORjKl2SehIЎΒ/] \)i΅P%AXuӠҴ{nШcHg)Z*QBēsUI$R6ol$)93r{ԣwԩœeDp*T,O^%/[2c;ۆ\@xIUwL}H+K%M{(r2)lşB36-otֵVET-[3@L0$O7hP1.Ol+ȱ7¨X bFS\ԬDBFeϝO脨3l?AO^ٻ;iXm 7uIq)0Kx-౩CI HSV`ZۍA߹Ddi12{/9y/v3ݖA=LVIyW\ӛIcSG{YKPlh=)Ո=iګC@!v~4(ABx0LlWLiPR+H?)GvH+$C5Q.%+ ;w gyFfI`N^e $;]"$DWC #{N=E`>eh.18qh:FBh8^~dyþ=H+$(sp5Y &g̕VLEyR@VX٠ia1uŁh؏bji= A@dysw1p|[N<4V khKlu\,gt#2-=uqvڻ{rZI[Tg^|gHHaoҥo*/ 8=CD>4t PPKMԂk'ƀgChPXXACÃl  MʡvCU¡(ͤ #P,?CIHFR 03UZtmڂMy TK]0onn8tpH2>v{4V?t6;*l: 2  NY>~,%*$j.0Z&||e+7&%&%,}Y5X6kM9 ܹ^ jR"@cDmBܐ׮g;8pM:nE㈑ Ix*MyxP׾D'ʴA+^5¢;PĄ&MSbbt_{!VlB@ 7'ήǟ[CN;oʰhs>~],Πњ e 3e99A+45.:{@5t2ɸF^l@/\`4ًq9 wp"ob0JRTf#2Mk&*P} ;gB-*4?`̦`ڧ號˙%дR3LiMCŷYWbv]lam )H#PP&I:ɱw$pmĨ&`nxwZaXa]ĵHZAhRA9 Ⱦ 'I(ҠH܉b[b &J;o)7p]+`OԲ+xBApcҒƲR/d[K ʕ~U_뉪Kn+[2yTj,e&V%* L-E.[XUJ9Xe r+!.xsim4orz+11YZ^fZ[ nu-2`OE8+&ՍOhd@>be\aNU)֐ G@z}vo! y\[ʔZ h,luROnH XKeHCR?MO[־YQRU!iBc4ի+_*'XRanl3,nOc쬻rS nbCd*v;wVs6S!aBK^ljbdvv'tx#e$~OɞӔ μM/j\G٣S$ ybbcRmnUz_ &VۺʻS} {q `LD^_;͸c3ڇ3w)8uBJ3.iG—pvf3^)^a^!Qٸ'!g. ${uՎ^i|2DNt:GEt Jp^$qҧL:/DWݿ"r#suSڎ82PO8(pP)QvTNꊟ.*cƴwC wSs~d)u#O3X2ײ\^tʲp0 iz $G(@b{0 -ζƶ\35MњDSZeS{9).Hy/䧼ukXҢ\3Pb>)ARh" ZR@u$%3LAi1@KbDP !pf¢GDA RxsD' R D G $8РCјΉhMŅ[(Ȩm4,Ԝ< TKakR9T!ĞݵB ,J?:  dT $J#: :Ӌ8k4,j, aj =IMFC֋P@LB%%zz =jh|oxTAFhl Gu(1)*D6R"/4<c޿Z`P޽4: p𓡰u8ƠfDH<h]=ZQe&9 jek 1<-JˠʹzP _K >dʡ m;@#ƘQD,Zx DPP5GqA|h 2/IU(#' Vx҆HDۅ'!4@%ң!S^C-QDxTY J<[ \H* .tt}NMis;O|p7$g- I od&c;*xh?fKsi}DMoʙp/P٩ y"@pf8;^8ض\: X65aXF|hM7>'i!9󭽝Ԍ833`Oº=hj?tB45"Ql%M=SZFyBͬ}(kAҧx2&T^$ _UNzgm^;ԈjG@Xw{}(w _WMi"C|F#GZ 8x_&F+ejDRM44XPE5,s6m!`pM\sOB;,=#>ݣ[ugA4eB|6iH}Vd`ύ]1(*_}l!Dn'#N{ SƧHBGfR'4 O3ztSU*^"$#O['W.wE2RTqmuyl oA;)ݐT)22`\֬MOJo:˻5%S%,υfŶF[/(;4$_j?>ˋh$=zVD ӶZ3%m%6:rD\Zc(vNiNDqeI(Ze&~SEiQ**\CJ9I(ü Y>MT4]ieV9vW4 Fd9rIa *&Z{i &RһGt)[&/b8(_SKep)lؤUi*9:SZg"+^Rx)S֋#i;_Bb!a͵/aۨƠZ~5d/G'Iya=)s2Zl|z*{ce $#_ZEE/*.촒I9$MƳXa_[ħv-W'7Dc>/ŗwS_SձIa  %@GdE˄GaYźO΋ dұ2IQfG @i9|2Q?=zS!Gsfֈ(kʁ#KPcYaQr8 J6R. }ֵBP7G *L]8R38Bٻ]Yz%Ov6,q[|hEJ~ R P\+p7JQ^V({ VlOg*LybhwnN (@ W=ݗ[ <\7zR? LЂ "x!̆%DiPGΉf< -ց,p $H1]NJV I&u:En3 L%1ٶr-1|Z^R3JQ1b-:PTwow L.IU(핛yylA:'liIؑ[߼™ŘLOqc'*@>!=%\ffL#lgMľΐaL8D>ɉz yJ>y*&%gTÇ (.$Tq6${a1?:dUmp))=>LZpe9'Ha"xn˪\KtCT4qԠ^UtyQu3hPԱP#^4f+2}c`IғqmrW>|rʆT 3Eu "b3ҌG[oNlydRnןJ?  A+c?B,.U\cqJTV\R55+ڊ  ,@#_:e;FL$4INl\,dHG~x5m})K훅&|DLx$au.%Ad%)0JoYW$V\"oBrIn_8v V%*&rcxQɾI_*ݹM5:F.?xdZ9|Dr)xJA kt"S{*,+7,8ZQ'듟Ii 늓MO~$})P*׌Y9cI{IH8 [IPqwDKX*'ZrH$߯ۘsڴyezUSuJܱ~,v>k ݞ䉽R;JO }Eo UaPڠjb;n(笠{+{€KG&ˊLHͮIX9FSiAO޳(J=WܺX«3.E@y#ՎRkuT"I=k-[ ,8r"iZvz,֦L,Yb{w˨3z17 1L@@ha>Q3,J[ufH]%MlMiE,} ~*8Awj_|W/0aپvcLJ y<3nlZTm!@A+4q<6%>o:e`Qb4S9)RMQS(ujd^^U&G==&5S#O? sbgAv_+&^PcV Jq At>5[JE [jiGS>Tί?h!rLޱo:TX)?X5dQ"֧|sYfI9(NPܑP|jHQ|6iL7k 28~4{>ҋ @@Uo~F4=,'2@bjP,^@  !^4Љ$NqxZ,.tHy֠!jh6{-9VQ:^ Ց9$UV|Nd6uxsY*j.}Dݒq;E1IZLljGov6g=,Bd=ȫX>mbng2Gɤro`+hml\0:0-ڸwac` OrLֺK2661 R̮r-nQ"pl#T9IgP#dzPO!Щӥ UBA BJҀDI3/}|:@jV1W66rJLIjxGYKJ3m=ek2OvH?uћ d+xɶaV)%E(HjM2W F`O_,2b< ٻ-A YI3íGǒkLJ6Y(e}(˷%J½SW_(aa@[nཡ/H6?`f4G)s{\$,Xy-RLZ`jʐajPT@tč ax>Pn17/~qוARQGnk5Co<fEz *4-5SmPq|/WGS5XA Z }gh: ɔiEkLyV#Ql#7&vRN I*yf߇ G:LVX=K F߱VYiՠMa'Ipc{m2cbyʙk)^TG&v1aeZɬU˥N]56[֠$gP&ntDSFH%֋zq,"DEp/Or{ANe9~jOđj$'p0d, EChD[X#̐ yPq4-j3=`K7`wVQqD,p "NFL} W!7 ZFldr}M|}o-JD7сP:|}GyyeL[y}Z>f j٫m+QCIstċ:ƕc7/;S#H#} :3It!*]+u($ @z]8`/$8YBV10"o҄m[XV0တ▣RVdFG9} =l I%Q~|j6͎(CKYr`*ҕFZ*Bk0QXY7:ZKbZM0Ӯ~R^ىZKOdHo `0Q'[7!24`BKO+dN8gJ?Ivn</IEbr߄MU"٘gCMHԎDn1wli-r lM^#mDvy. L`HDyԜUHmBtsTF:YT|,tG֏Iz ޡ?İNPHUֆc蚔ѴcR^75rͧ(^ʌ.!K*1dBI) *Ku.8,"R,g[oǿ[^ R;~6i3VR\},G3A?GO5{d_K[{5Es~|Xhiݢ0*pǎMW]';`2ֽ1(? <]f3ju/;!#J$GZi?WKԄbui !=OE}Y/|9))e<>&i.[l+ج[ŀ.Gt˭[ [5-ٍT@ 1s{#4M;{C9LκǷdmȐ{F"s\ę* -t6=ss@f<8-' ˅bvq5p0"#({8i ОT8 }h()XNH0]uC*AdN(gޅ$Pe)Ia)E<V5&p[p5HQ琛~'Yt,Fv{zKE@%D u4*̷=6p(R$s$W6YTRTe_08HY {\WZ. fl  g>$q0uE@1Nf oi:ȗ jϩ];29qsq#(oǟ*ao&x:u$z+l}Q4^@y54+H7Qsl|qoL|o"e hss^Of"RU39~7hoYrWcTYl&tS텄 kX*ȁ I?:ތGhE0NUD:UB;QRDl4dXEk?:SI8$M^ 5~:mYG̕^2*IqxT!- d[]Ə!+6ZWJxrqW%V6һн-4_i^%j2M~bJlGy27܄I7  Q v*m@2<3nhE8Lw[>ZtDr\beJ10bT9V~耷HjP#?]&$̓]LԖLDN@P+grw%q(w+:ýx迕>ĝk =} ;ՈS5̕NzSOhjwq} XPwQgUnҧuD lJhfu)n(_9~Ug# }ĪN>ǛB@MN>kcf$jM/uA1;J㠩 g~17Ru){Mlu6;wܢkb?c*|{NJwşq6>Ҿ΃_5nOCRĠJD+Y{ T-:zyqEaT4ҠK'Z-X"-6ۑ4=lє1nuÔgwHCJn*4$w!ndBI3VŌC=윯8؞ W^FBo/kZ; YU WKgb:q T@p5\r(QBD=-5 }"8J $X )J_먵

Z.!cZ}u?Rcn$0: &<$AV=Amk}ž%!g*Fx:$cr lyb$?hk:.(\~?4\nlr"`=G YXWx>6O1NX=g*a;<փ/F[8$)"<)P`άB L&:?¡')&L=yDB& h ȨCk"ICT +5 huPuJo,jDt(q|*({޿(JVh(u[>V7{;qT*#xՑ_d+^0q m ;+_9Kil)ҥlƱ3TVg;̾ EYoKr{Tgp O}]#J|Ѷq܎!%'+h)ӑySڿy4oaR  $\ ȕ)}8q+Bkgo 07]o,Q5xVXGF݄l"8ɗQ1KvXڪ p+0c:ڄrDpLوŽ͠|ZM,J1`֋0aKx֣ $#֢y& Dz $P!LA!Ҡ҄RFz[?4CIYB mQl1oʢ= W~;s5=Laqy@vXfqju'*q$U(ً#GJ~R){BF47^}8_&#,Zq=ҲG._w ){˿g4U:T>5n 4|kl8#9'%nLmAh 7Sqዥ0aF/%)6PoC=J$ mM_faZȺO](MZ35kaiX E&팣=+0xI>U} +̝:ֹKSy~W& R;V_cF> UD#fev=!A(u1GxbR=*$)1L&! t@r,jmY2vcp?:Ѥ!ʊ+'6 f6#azԒQ)&p8L˒ kƬHEUmzH6V1*B3i3F:ilbą^Ji5ۏ +>'#?ͪs~c¸ϓPP G-9jS:x{J 'R2D:C#2M 4r/JBDHL%P-T!?7@# qgI! ؃@,$L(;=dsC:B-jidȽ1P+LcN<*uF{A(NeVr>SSp @H$<6 #)J|ơXdk>_#1:^^n~7aj'EdkyyֈY>vI130ҡeCQ!/Ӆ""H,$U@uT#ϕBJHD]y %@$fq *"2bQ>Kb9 Oa }ÃfDaV]YK,6Vmr | S8J%cY6xUf^Ev[;u*#Y#'GqC ʉgHo 9@}. NOkВ=i?bRU?țz?a[b[Jm.,8?W,T0ۖ8;EntYetaE'KnE`#K^cwERzBm DXEE]hÝfEƼjZ(LS8cD\JgO_ gDL[峛ǔT>~<j)6~椔NtJNk_ʴ>ju_xVd"c4t!BV@@+qL.w Ju-d ³SHó'(r٭ yGlb.D8CaBh*:yJ"D{;JLT'HB bLaF. K$_נH^&hqil۟*|y4f<+m(2i"U%śƀO!Έg֡3TL҄QRmdFDT:IA7$E(GX$ &3cʡM@|f):߂.6ocV$,3t=iq[ |NRIJrXfTc0F?Hž1n]ejE~.R*Qز 2yvfID /EWR."{'2w{enĂ;*MJ,LE2nlO᎓]r{s1STGaS\\̞G'+,6ԅu6"gc}*R&XULC)JtS#ӷo WĆ V6$%Z*_d5R,wtOoR1 0[@UKvFF :p(QՂ$O.Bܟ+BtF-aTڐk 9DB B^'n]hNK.D3JOM;G aw*8xEX["tCxgChʈʵ>8&pJEf'te+, {v& 1DꥩQO&DI\/uF^!#γ?㮣{+ BҕJTd!YbLꪺrMnWAEuN" p:JL@ahKkHBT TfpY)be>[s҇fp=@~EQKd QQ*QW $HW~%RvS%rN` :&JIV[e~NTToN|∱^`y[n103-M)AC+ApJ͏jܯ~fѯhyKfN]Dzt,Xolո$iP UXhuiBUPQtĦGMLWkhR]sw.(meաrId[Ov# V9_hȭ}*hE2x!Iq Bn[{JQV!"flk?f,¤ ^1XE &Db&טM;_"S& 1hg(wD!B#QPPz^1 x &ǝB :PQd  6ICxS vȸPs3@aim#(, 2t8ܽ[JB&ϔ^9ܞ5\{?)Rԗ]Zl0!("D>yu l/094b'{"gn ʋ@fMcG?oblfA-A"gE 6d 9 ¾٭xuIL>gJ PY"*aL!wc@+(O5N{-]V! )JLBB@ZsF)4:޹vi!bS8S2E>t#[X4+-X [ @tyHEpDAoEMzaO5﹏ u0R=虑Ϩ2("6⽈Z{T5 OH|jImȪ Z9k^U5 v~u.2Dn02t  /*H2>^5ф#7&iI*eIZIBB_BnnO4mu+<|X 7t*d6V0hD`7y8m"AH$u&v59aJ6j{6өf5Ssv 4Hûs ijQԱw- wV"t(c{:a2oocm'hJk\kرa("Ƴ{Cب[b?: cn܍dyձF>e}(AURD 7 \T,|+.V_ڔSyEXmN'*gN6 w[ 1y<4 m q`f"H˝w9BBΜKޅuӍ&D6x!3:Ͻ +Q}9ڽaWDxev;~1Y{O[OU<ѸZRQQDmhvBxQWh8ޡ2PH7In6#Q#A fӅ2#2 `~$[)aE-7M5Y8[#N4:U448ʈ7D5t7C3D8A L7ӯZ$<@: ڈ@SqS S}jy{ c[Ҋ@3wt<(H*0!P kυBډ)$!ja}޼A8_MBG 8 kT!HߍB +_B/ u Aʡv=qjT!טKHue #v1J*$E31Ch$7P"2"Ԥe1~L PI7kB &t#P"N^5pFO¡mVNk3&t(J~$Bo8.!IJ`#)%$:AET^̘Bx^D3aqtھDbjlLf90[%y-WFI-V0:^YG" )='ܖƲ`* cRxUD^-6VU9E` #L꒥O9EVoqއ6sa+'I0,y^)K!xh %rsEDx%{MǜvMd<W,:wveCm ZSԭe":TiK{`!eG?jVeAD:ɭxonS[3ew+LZ\}jݠ}'&r-a12|/)S{ֽ!(PY"^5fL]~vig2}KHZ@mHEɛ‘@{;AmMڅfIHZ+B&dmd''"+(itjNF&ehL`4+Ђg*ZJ0ɄO!j rҖDv11 X[0[PIl|=-QBrR 8\M hsCQU3։3SxR#^t?vֈwny|FbiL(9Ĝ(n #DMjK@JIŠiʲr]Sۼ6dsRzՋ#)uIytMp\ `N 4{iTÀEo@ LV-#V8U9xum_hIH+$Nkfg4Sl )zϊt=0喞qANCSU]\Fdz VaL5 σ*aXK`L?Z9iʕqB.>&Ƙ(C æ8*ϩQ<}iXGBJ<aֈ p@ x:-AQ@;5V}JFw R@o:[~|{p'f;6c[OاY PI%RL@4Bj, Ga6>W"3(uҷ#(ҁ<)TkU1PJ|HY2=aI%*Nbh\j [*kzZ {U1.˱.JHWr<#"uE= gkIL~$Ye1t:S1՘qI8ע\- qi EKrkM0zE _BZ J{[T'-u "O[ ׊:*KDA $@ q9yց։ZER{ APFC/PZ}bCPY:T Ns}(B"@$ ψ@\5{/ QIҀE4.D)Ť'^v5!.Ӆ8UDT')PPHQ<[`ˆZ$=ZQ@8FAj}hWeÄQ OJ  !TO*8F!։D_@"!ҋߍXA%iyT %r@#L@x"Co9¡=j(i/DR"mDX En9iP"F[2?vʠRxA0A*k*BR *(s޸b !̤qA~!i}f3Bju-rgbURu@kbFOS>QS53y$Gj~4GК B?+)-ʼn8#.5 :#艩;UEzMLw4ZhwqwE#4;F"|jwq%6 Cu1o~%'MxyTMLws?^ k~1+1I<QAD?o$ ۔T5 ׯSLh Rt$R!b/!\akOb^#&PDpY2ce@s[°[QRڼ(fAz9d;! e?YE@=O=_`PNHLRd52= DIY;G2ovK'Oi9jhMQga]A5f6ӯ_PKtQlxƥɄ̵(/_:ZPZ Mi"8GMs:%gⱒ}ۼ9JsýQI(=O(F}yc/ [C]ӑ"~H}@F6y-YS qd$NNprS)LƳwk[N^ U->x|W5쥶lAocΦ)1%Yv%O_6ԗU}?2X5.J$'47V ҷx){j6Db$49\Uq*a1 KF%3uh\ViO{" @7u$3DqI󧊾i}wۂes$Sސ; :,qb/pN+-a2t@4Rh SyZ6nGZYC@`fU%\ 썲.[xyOI pӋʓ\UJ HoT 7ͤrOfT2ͤҴwz=jVr!n$BiuA砠}Zvq-뫈ݘ @8(aKIaxspcCb,nxEg\{JyX٤,&s!D3O'-xJvҕl:>Y )^P)ԅhlZKt_n.Lf?&dݯrQ`h 7dJNNٵ**v2:&&ua yah0>T>uWS#N 7wxV('1ֹ_jwv'+?^cbAǕͪv(rr%8*=҂G2L{ȻЏ_uaI H' |y09VbӃ@'/Zg'>PyP!/-!LAJEkƕl>[^F$NLt(kt&!ŜB_x)NQd|CWT b\4e Az-ҵL=HГe ':NCi;vvi׌#B=)_ ׫%-v 3tiҫKTC IOJʑky}hzpmxơ($ZÍ1Dž2DwPMXȧ[_v*JàNb:aFpQTTZ,+PJaA]AX.͗)$SI O+vd9EDHSIitD e@+6;59l u:nU8héê77DyWvkЯ2XxVT7 c[u8-cO5܆_ }mi1hd!,#2'IKwEǶVqNI&| EiTan }.#Гz .B Eh BpzWj MXU* L6c<4/S^ظןm'OX\l'.NU_r䩅F&%}jũp kQY$ׅq^j)lې$F4@M g+1Q5~dxV lRx_ 1[0y~3{\2`y@sy׏^]ʑǡIe$L[ˍ9 ٩[2sSe(tɂV|kDŽr#[rnE4J`Hhj {ʼ0Ϗz9{5(r윏c.ĩD1rn)Hu+P԰ qPBIBcAm$ AD%b &sE' $8[ ԮD$TϾf8~-c-Ƈ0R Pq Z=:J/XRkaj$gve86yG]̊Z:鮵g=[ZKľ oh?W'@' 7 "BIa:p:q{@N]H4E\>΂KwT[!9޵&A+$JsW-Q(PRʐrhYPrQ؈]ՒcUɠQx]jRO>$Uݢh2~D6ҧzIæ(wԚlVuȀ(w:lșTt'f'ARiCGfhAS[&lH>B(?diTɤvccDAS[&e>M(HhOJ)j u6.,I(PVakNJÙmMS 4Z؝Ÿ`&DVa#=v.<" ۄˍ;8-N_i&mJ:as"b4vځEn@GH|)bm'8Ɣ;贼',/y]\L9!8 DOҮ|aVja obp !J ɋ#[T:hOPScP?tAtMLZ (P/ߥE>re3ȏ "q5%m)Am\ߩ 0͐}>[KifpgJy+\&TNƟN+)d@QLǡ4ږM] pnIY\l:xM6? jи`)HB@57ОYfۏ˲ՋٸyEtbÈK%~ gC:Vr¯xɽTIҶbE Z+,IB9_nf~waiI9 ^ZAvr2[oE7.)%hm(ji&'TؔDlRZbKʛZd ]^05%Oa)Khɑo[[@ 2rHqz&S9+ ʗ*<3W{{׷_Ri2$Y$ *׻<re1t81jdDa$&㉮J,Nj[+ʁ*'@I!#iĒKW][5x| %*rT{uY%s.ؗ/`(\iKu!KCDYpTJݑVg؅Ǻ/)KNqVE6Il.BǷwv'\#$' mW!> |:'JSKR.p1(.'$+Uj'-[Kd0;&U:r#>yqM6;{1^jD?NneZG5U-lFciDucY%%HIڕvcLQ{N#2mQ0%yB "*gNtVhqHF2#1(NH%Փb&`T3ӁJna Fo(#kBy*2p@`foi £14^uÏ{3] 8FwIb2p^.R83RO"WKG#\Z?5~g̓Y3?-6*(!3HQ"2]:_:c~a%b O"]4b (ZS$[VrK]0V^X[F#E,S ta7>$*ey0/cx صIfxQ V l /jyVrOL, Foە0mjPDXH 7}-ÝBB-PjŤ&h P0T Œi/¶ez~+)S؅0ZًS={.a5f~RxJZUJ!"Ɏpi'T|3![$* *1L>dGG*Ǘviilbҗ 9^Qqj)H:Ӕs smT@+1y I?*AR_2[ χ3mgX{0ɐCҾ-錺}=0Li6tW5aOgsmkqCCNk^T٘4 6ҠJ]$kΔVs fQ1@#hKE 6>-QAHVk߭@ zOP^dD346 U(EҀDP9iD`P *A.;&Eƻ|6 cZaQ~'2u GD % eҠGqP[QB:0u+O:$;PoP7:*RD#X,/ "uC@63pH”"AlwE`rLFh"uhBZ uץ@RHWPO*H',ۜpw LGO*l@$:(H1ơP~ aEjx6Z|XqL,iVdmQì@j*q 8TdYx?:Qν;K3`) _/bJ$V$jL^ r+ycXR`Sh'L@[uĤʸs{F#V r~lڅr-si+LP!jeIRHrTg2~ѡ)$.5!!,|8xѠB:Pu<H4^hH|R Z$:q4t.t™XvICw%.AۂNPgo*/E(F^k ÝȠB.14"sM>Vl8(Jd P5U<-öaYHB$ۗx!T! 5Q ! r+$ :HI(Ybx pB19B$iʡF3ʥnBVC-|" n/2E%"|f\Lc{6ₛ+L%Y3^d/hxmOl:ێ$X:W6bES\_qg x GH x&9pe( bA"".`X@SAwpڽARp24Jw kʶB^&ɥxs(d 0hYSI+q@eHI9G {4l ҳ B 7AҘ4oJ8TYjՉüAR$~\:4 nfD- dA`t)Cx#+Mͤ}HXTǏՌ:eI*TL.f/t$_PrA$J">C%+7a)IJ($mI? |nR"ًI# |Rقr~>FOi>.vSnuI_)ih+VWxLXSok}&$q;6O!SB*uYIJDbzUr9:bN4{7Q$A.9Gl+oy=@W-f,(v(r4 v8䱞QXڿ]K\n>lBG甎5I=7Ԉ1F:TҼ Hp)gFB.1AטQ1H =j 3z0#3yO!Պ.[![GhoÂ3!q 58vgr=r!̤gPTdJAԍ*JzvAl. b 7Z $k=#+n򾏃6ƉHN^_oR苍TlQfx|\[/BƂ F@Zt4:~ 7Pb:nTJSed QЬ`GPSM 2l7 >}iS ( Q ԑ3=iB{ ]+U@$s}-[p IQ#J .ST{ax Bv~ -ߤ|i CrO}*OxXO8VwEY#PS/CO8t0~+R.K_WwW\;gʆ) Q#Ulw Ʒ>Z@O@IY)$$r<+f<:we2쀬vP20`[e# $'҅!f)e@$]xVm7dY` `8M*a`|e*GQqeI痭K%@0֞诒 3DXvA(cz^B6Y3kM%uєJdl  [//У}r_Q- ًhrn˽2D]'ֲe4@6p,%J 0Nuh,RD_Q+c{TcxʻnDZ]0@f.\>lTRaV=Z'0W-]5/N|BMa^S^MR&zr1ӥw5HfDQj$eL:P!.`uҬ¡!6z8]Tq'7A¢ "jE(uF DLTd9l8u0-@:P_48H!T Y3Dz$0$<AxmnLӔZxPu6\Cʈ4q+ ^bHq9C6Dҁ= h1eI36P $("Q g8u3 p{ub0D Ɵ Ilens50'-\v24b5-Tz* R||4k!&Lo݀ZT%:eQ0/EsC5{h:PP=Hڋ=bb g sf-6:s6aƤQ{˴)HJNLjdU-[ˌwBz"NDWCE$C8?Xi^GTf9 C$)7Yhx} he;rNW̚;R#)ɶrxt aO: Ϲ$Ɓ."rYTPoJ-A|'&M@=>bqHNs1%^9)ԛ  ~1] @CL}.oN+ lABSH1SAE[ZHZ("N~,XT NR7D =#^Vx~gARz}Ń];VM:B< yA_`(Z s[3տL'[bF1%+i6P:xt5VqRPB}iHb=+Jں+jXڪi!k qYm*)\oe 6ƃn:1:(G|.~B lU))L#2OHRT_2K.~"KA aᘔ2D ~}(ҬێY.(g-DK@^|\0Xwq8hQn4~( |-2{ud$}?aZ aaa2\Im(5(.-j 9]foS {/)BAd6[ch*"\Pp*pPPFg[\+JBU2dp[)Kgi |m)J P$ʁts+_t*f8"[ʐ#Bs/Q^ftKrɰJ5d>bN`aG(R$ #S \R ʊ] !(%A@ L}<[&QcJ 3f:1t {3 kze\b(4ti{wkN= tJʹ B~8FRЉYh:N0L@-aUڲý -{6a>\Z̕QD'(f5)R*gB + Ǐ*)kdq]VTxANRLyDN<ڒ)~!-Ņ)Q* }.eQH5DCRSZ!ġd{ǝ"W+~)mD>گ_;xrX vf;=B'RyƲN[ԫbBE Q?: "iP]],&JuA/,:q:G@#+"!sp?KCMJ%a/iKo9 Qb%07:YM0^Wf*6Aaa_F€_"s=yVC2D ?\AYJEj]p{QVPRLk\d^ " i)eAjKh ` vr[~af E}5v/08ƒkfž֜ 23t8 ۅAPgX2)flPaw`ʯSK:na*#uTsҹ-Qkq xqA-eB қ l([ >hnMdܹ-QHy)l4S`` Hd)y鼊"nD5HJA<ϝB 5 5Z ۉPrDzN#lLZ#̙5Jd3)6"PG&-L=Nt,_^hWQl~k˨uS +QqSk)!&,7jDʱW77!/q8ni*C3iyQ ͪHJȓWĭ z&(uY'@AHY&V V,!w iܩAO²Ap9JHIcO:1bIZqB 2{Z25t+zBZ*\  )%&z_@BQ_ϕ뚌b Y9A&i"b @< {ĬU / Ҭƪ@̜ Ls{9lV!3+<Ӌjf.BWeU.JgS~3Uaa|D \9p40p_SOImʰgTi%0g.sGb8R n/0),IL$V ӡYg܌JxSi/R^_d:Zm- ;ovmLOʶԶq<)twh`q3@)h&Jq)"mI9X#‰qz$cӕxT MJ9nU3K"*^QEiA393VRs |ٺ3Qר ~u{S!Gg36n|ȻȤ݁* ?:ї1#8 %^^U0+z&̺Zr%cUca m *IQj;E6h6) 4G nV9nbĘ=Oκ9&]%E&d)R9"xloNvԢt!9{3TJ!m@J$,G{AK5M[Wv+aaRSȋΜ˻p6eqJQer04*9RլNU'I>H߼>s >dvw%/"B0{v㝓VIt*PLwjר쁇h'\'p\b[eXr+MLs'둶H9cj2#<) \8DѽVx6J $QIc_nĕ$bAFStX+ZcJA@6tԗj{9x|BYP)HIИ7+L4en-V*D 'NY s,@nmYSHJ|ptV D[-}L{ibS[6BLfttNnyeKONaAC$MŗҼJvPݚ 9A*_ *kĿVY'),- @J\NR=Ek%MpmD!!ahLwQIXg0ﺔ/73K/ ?bmЭ`q"zP;oK?edzK=Yv^$AރY5>bNcF h)@A1Abph2u"V3|0ؓr `Veh*zZ,(+$&c FVĞDa-+tLLd5֭щ/06-x\jnO0nj€"l4j=?X$IwJy"*0 d.#DRaA ?j"L*Pd\ANNu5&yJ ms2mݪ\RdTfY^ ^VJ=@S>D8P Ms * ֫~A"vd6pK4Ĩĭs^nvv9XmgYѻtJFe6I6p4%c o֡0BY B/o} "Fh8)2RqzQb0WcO:K8r *Q,لt@eT@$<bgh5Bnt얋HIuR҈;wqӝJ70f>Y[TKEf,7e~@6#zقT"fFi]J2iJ0.(vWh~#^5KiY - ]Y&4>Ve)0+ns`гz#S\Lfo¥MY ݯ }{qL^LfxyJɑyrƺYa;0;Fׁk\ײ.=CK°8fH0>&-?FŖ,5_~ Ihm{wE]+^%*!n Wҹ|OOy;B y(%NQ tGDUer8ye:PQj`T u *1"ŗD ,0²_e>ZPNՍ ,&4`q(qY*NuKT6*[H(xݛT”0-EdU"idTvP`O!*"]\, STQ&m s !i!-Sq51&KPX! EJH륕\Ltݙ[B]yV p1ZNo!`0w 6Buu<` \J7U~쒲.m,[iD!L瑚cAN&ɍhoՋ'p!0D&G:{#m͝e %RG1Һg|FVҔ=HZѝ`[JJ 09v:/l擙J 1;j6= %[ _'`o:jp#BΗ;Cđ xt5h J$MuxK>ĂGBs)$EiiLJk@`eW{3}AϠ `[9F>ЈPҵ9l>i>Y)en/HCkw5;,il|@Q$)jRЭZa+؏/LX3 H駅f֟Eckv * ypQ\I.aq*'Bpt#Dfd>x`& 'Q {+jq%I/wMH EoXEgkgL,4T2.Uh P&@)"z яy%8wr$s$O3? m-!ᘜ(d9ɟ?R>PgK+Rl=T)f#z\-@jj4A ԋNyCDX[I!Ww{7 #&ү7-ܨl6-Ŗ#T)3)([5eʬ$2"(ǽrCiEziI}BJKGfI15\O%wAV*N4:qa=[X;q NoduܕG=r::94MJKpUt )*@`4"^fR[DҠs^`P bɱQd@O(F[ƃa > gDGCȱd$6L8t L^4_IKBIx@ƠQ 8Tc71l7n `){_B|'\2dь7-TըI7hqpZǍe-wp?v:'nU?vMq7ZI1E#Nx,m:QiSu?!;! IP?(%fӅ(O7JnNW>B敌v4\[Iҙ1Y1D` Ɓ+J5VcP;ұ1A<((6'H, B eB&1ASׁF1{m `T cεa%3ل۪ob1<ͼٮ8rB O ZUD'NCۃ#DbT[O®%lEg)ҡR,9EVC~\*9~'ŔFiR43HfsfYV)+J$摨ӇJnՕtbJm!P8ƾ\׽k~ QDo+-r :ן^o|zQ ½'1 =$vK]_4 56 Dž*  =>w$Q T 5L oˆ)3$ڠNt!eҁ%#XZ$d ʡםv9 l CT-Ή@nta!BUM|!z :LBljBUt&*U&B6ҁvIa<(eD+(@O(é[n SՖ'WJ3ֶ3#L%ɀdI4@,})[UN) ;䏽80Da(թRr1ƬoŕpmɱXVL5:[4[K'㤄HH xMCK*km(\('.} Gpo@NwXI.ITkڬPx?-)1"e&t 97sJr{.FT3APyiWyTLGdcM%I:>uKp`q)i>4XKS:aR]hJqCh74ŭ$!DAaV)f>Ǖe7)##,񩦺?ĿXGr8bP7>?m/gR  1S`$ӨOVTඛ+∜B'n+D^lTüHqPw~&d$C lҝ#:MjA!6@kl-P?)k H=>LVM"9h?a&"kO6Ki I>DQc6BlJa* *&G)ҹl4FoLX .0<,G;~P)z8an|zAҩ# @Q: ?m9R'(L@Pd[M+Nr*&3Υ*BRBe.}j$+|{"BprfE FV JN8F/v}&&ˁ&ÍRXN%*p傢i`NQ"H 5؎%e2TsJ+-^ ݲ`IgV<ؔ\BUz_kdů0 TkU0'okg o m5HKQ@oy'ꍧ,xfUKq&j]CJtVk+׉^iZhwh6 *cfur`\!)f$Uݙ(*{)#=_V>%Y#,)z[CdτQf&HxXk/%mdR*PQGXyȢL+Na@;~[-@Y]s޻`FJ@Ď1VA?gXn,ix)sdpU۷I$ 0|EhZrx >5(eph2~Ȯ{RЪevE{:yUS %NoPٿRb n\ջIζ3<2@z|u} vNeKU0́ :5{))HBHXI$fy54+Jt)RԲҜ') +4dF8P0wX7F,ihrIݍ}@5N|z_Q*",0쾴J  &k6-f[[– O8)ZcTemn Ja) 9Rrd:6k_Ѷ-]1*rg0 T_PXD9(:KvSE$mh1  *hgxpGB=Hhsx6Od!ЮxԈlp9s+`ɯ c,(gEN#۩*LJude nA9\s$[cKCEKy e+vxP)>jz?V8,%KV@BLLG{ƭn IRAO͔} mF2ݜZ{BPT)yL|*:^AFy9P;qpY -',Wо!:FʵKYQP T@&txYbܶ-H8ż*pCogci{RmQqhOՌChR9bj=lv/EԂisŦ!7A7I~GջfB osIO .u4 gi%_}+dBKbpjݖ% H1u15){zc1jĬFTI< ]bq<\E'Kt[ob B-ӏZn}+{ ";v+5z1KHDoV~$ya"8B֛*(񵰁*9TDHUŨIJS)9d!j dTQO,k1Ը$AF+gOOUT:C*eδ2OΧ|R7v:C) AR8n$jtEJWoAGUK-1:<}k!p;&#\dyfTw#08Dj ;iPC\.$ҡ+ E|"sYWpp7Uuc?Þw ni9s̝E1fGs~ {\"A<{ ݠsy-͖';SOּy*4b4UfųqLԶMgMT.Э ,]Ac_${#)˕vٍ?Ne( RoHÚ6tNlNÏUTo# Z1y\21#Kr;Gُ~t`TYY:𬑆EnvHE 4rkgz:a& O>$IM˒P zT3R_Q.$>-n@P'IDo4d):EaD qR.=(guA+^A~@)F+#!*=hY- j2@ ԉZkD =GX>U-:PaN(+€Gg:6`AdB_dɐ2IVH05oOVQsuD]~ȭ)!f;q1 Ǖryk@pH۝R9LE7$+(mcX<5ty*XyW@x@R"!5nHqJ[cɢH&H6_ Hn$D*)FSz . i p#"( { hSލmW/70Q&>WjdXOVґ*W(*:jXDNSΡ8aPDҀEΈ8Ɓ$H ~G$(ހE!XD aB`*JȏPg?fD /ځ*PX{-jƒ!ū(IT" Q!䵖P 2ޠD%AuJ` ܅ҀD%=A4PAhh#^;ҠHd$Rx6A:Q|*PAP44Q2IQDd'K 8q@'5-?JoÕB%W{AI[hJB"!&P#6DJq:Lڃ!Ԣ/éAEv# .&D(D"@~ע*Pu@ɘZ*B BJPE[PKhm¡"T9_iKDy4dzCUJ(àʈ /ny6SRg)B-DEoJ.רAw$@"z*/LER7CS:Oƃ! [Rg^P&AC1¡fHCFúJA5q -‰O͚S$~4,"\W (wˉ19}i!e$E|#MtN 2]W\5cU r7 L,&#{[`sЃCTXnn 〙9qJV 85k viJ ba (Pa/IƠ~PcY-3bOۑ ~4f?Rp;|0u ԇ%ؼ-"b$kE嗬;/n%$Ζ'XU<ܚʽAeI]*RfnA$Ԅ8Z3\U7[?62o}#ԓV:H;q }sz];Kjly;.Rd; Kd WVYUy";2NcaeNg֖@u󡨪S#mM@U}tS+Dl" P$4UU@Rވdi5Rsvf"xI5W"*Od2pK?"{sE9_L({ԡ$_@.l/MEh]$TԑIQ@`>;)fwEu7 *Og`(O ?1/=TL]`-Y{K/K`opA|+$e.jќmwa6Ine+ oC]lyVEL( K}F!.}hsJ.; ;}uN)n Ē,DR'ʂބp+67[qD! H##·)KAx^RE~U;z5Pqa!WžU47z9bitYR;> AY,O<HRn:,*BgJ(!e R D}h:PB{`lfQ ,́xEEaHQSjQfB$}$VOQ4W,cQ !KlaIH3 QNIqx4͡R@,w"՟kLcg&5 u kcj91>M hl:dYQ{6&v Ryό '"ǖC  ȓobSjonVaKʣ (vbߐOrJ`)) RRGl~ڎcxiܨD< s)EjmCx:U2,Dw 8ݚL["~v1$@vjw[Qm0ceR'&Y%MH枵XWUD 7[[/{kgk ZLtj[fSMI5&p(}~-WM|1`u;0_n36uǘםQR̡< LVHE.w& )Y2 Z1wJ3٨{<(LW#?ُjSFt:0{Q SNCL}L6֙y{1D?4@qyа3Q@,Ɖ-auyuAIT  Ah2?D臰vʒ,O*2#AYH12krxSPÍFInDK :V PҒ99o#P.@)FDrMB@e¯Z܍<B킲XnpeԒ}ހTUB1PO6f(7a n[?#-|;]!@&MM a#g4l˿Rߨ!Co6=б>5|ςmq̉()&@U*qUԦǾF#G-M5R.Yb>t:E/6I皏QIniHz@{ $)RJ #ˆV .TH:Ivb( -Ә?m[zvQׄUgO+vv=C.@ͤ$E[Zwx'r45MS$72Q|Üsߋ>P7we, (KGN:p0Fy˄v 4'Y1m$[> DcA.O1K?gȭqKDă2j]?gj)Xp7 H1jfB;{\;-AH [$Ǯٰ6\k2-!TQ-:քz#ܟ%/=ǛBփbT,I< *üz1Og`]JQ%D8?+LƄW&jb@Tw +,|':i N,@ZHHB + VhS1P[$$ qC\8e6ح━&7˞I1}-5׸{b^lQ !t 2CQHP$(8扃=4¦Kq7bAR Oyq6@>)B 9Zܕ(YU{ThA<ᓼUܮQӹ=ͬM< \e1؉rQMNVijd;so7gpMEW<9*_Çv6.sOM*wվEԎ<#e#,t-E/DguD) )$3SeůqqN̷_y$Y ^7~p3/nYa.JO]J|Euz橔3by'_~DG1Z<܃҂ f56(4 Z*~#I5ᠨݒ yB` mŠid<: (XSqʀIxs23@$E;ؓ:ta"T mu0mQWc"P>?wk;~J=EnD wt!" ZT~˼<kHtx\hEg-)B'5OD+7L^'Z%r2->y$>*֡+T]0 [mLW{6zEef,A-*E4#i9ڴ IJ0*hNя0|xmsz#=G΄\%%hTX?kM߳A׳}`/VƉ.ʹFCZt5)&hjjS6P &ڝhtwT!xT K`t8)sL,8 UoojHӝ@$<@dQ!x#ҁt0' Rsi@_ RPUBh|*kX OP.Iơ%J: *c4\kƀOBΡT3C0-i 4?B;&^_goB iС6<4k@P i}jhJ- kQq.xyT QB@ƘwI>TF_Q@$'pMXdZôYTT3ҘRHT)gҠ_Q էA*Dtt<*g4ya4H7^N v#Θj6CET 3PJz*@bT4ҡH|JWT!2U5HHܨ2 4uŎ@Hj0sQ&HB #%qDjT=(I`O:A sC8TPAA*]D-,jRy5d&,txQt &ոI3-+G=3S}l9 \_A\pU{Jp!Ʀ.#V*ŵfF5AK2e*¸oLjB%fД HTdɮvwN"5V?s[SqJQFn -Wpxΐ4 q^5I٤Q|}K#+BS= 49.)6,eqqcu%KJGd$dHԃ2>y2TL}zJVݭn{gbb]I2 V(Vf-$ (͖ D4"KmwP$M4:ͷggH.Nm2Fc{oa:!d`)lHN6Fh_O!ٌа. (,Zcö۫A34X"qHVH@|~u[EO!DZ$%I)VbH*i~[iSIĭsʕO£u=leX:1)YyK9L:rޔ-]}`APLa:Q:҄IUb4])|ᚏ(b\#ޡcgr IX[3*I"WB"e.$M(囸|y*|=oO r@#; pv;7?/$qJjI}$JnYv}_7ȅ_UGՐ am=ξaBIż-R|l lk(մ\ &FiM{uYeM" Yd s׉u4pUws#&iR@ ȟ:aԭZ]1W1)BiDȈFX , _@v'hl@K $" u;,zVkt.sha٬ z\Ĩj3jZ詪,s5KRr1Sl$ }j! ҳUT $>PDx );aR2\ɉӭf<2J5/aV(Rx 4[SoȦc3a{҄*P:^|?g*FEɹ𠿄@ <"Sv?cLnys+`{vA ?\|\t6Kf8T'-j̳x7q{RIT T5<_EL( 7G|Sd3ʾu6 a;$W 'A5y>/{{qoB3%!D($kS g}+' @)юR#0T.)Jid%eE{hك2KDžuZ_ %h%J)qi&^X6HԘi6*{aB= &lbD$[X[>݄lV.ṓy\lcE*"Ie&oKcQg#Q:Gc1$ Εg @HDWȨŹ~5$+IB hXhR6R]$x,680zq>B._%>wav tӇ*uVKBI _)\m&ٟ@e EO73W2r&1Tz"&*ݺʎ[W&JVGҸRTޝuS:rGlG-(2[[ 6 œ(tOx뤞wfH;Sω]?d^1$cR[pfI~#t~ >ZPkgOv`6*6rJZ*;-+,jTEާ@º9Ḿ> hؘ>u0/=OJqh_!z4$eGJ„ @l'b A/ p:d8|h4H0݊6IABo0UL_*7@9d\ޡb)2U!)B~U0TT$/"D4@s3P,Aޝ N]c^IA:?}) ,J1T'Pxϝ@[! }f?2*{JL꼏 @/,$D-Zx+v>L7a$a[ :e3l8&c0HPIm~P)B@#OÍ2%;qIIqy[2@#^+i$zUJn)G^׬Y94À줼 x 9f\L%g:& JPL1Ýh FQ}nksxv$X>A#d&,N{1fˇI|=b )n.H=a\5bJ"0$44ӕ,FtJ ʣdxfhq`T5,f{qyWAͯƀN}mD*85%'B"9,iF:聒l5: EԲ E5*J}ېiH:4@)ɞlmgZ:HCq65%ŅSoPJ eCNQ"tw>4Hy֠A%!Dx'()I H%3:Qk47MeO'@k[ѲQ6P]zT JD*[kϬG $AР :<\R[e)o$&N eP1½7Mxp}S7cn. jk(>6?i2(x'imE븃77?)ʣTi򲳘 5]6å QR3ڊAJ؇VvmUjL գ$mCb&.@yeJ7&8u PG7.O\9%-lcJг>}RR|/Oq>6!l<ƒ ^`8얕~7L a*U p}*M% Cλ^b*P3Pl/QAb[\`3czdjxfRbI7dHR=v:ޠN'z cфJSQr% o38rs$\Q[#';RaH-Kg$KRߧ\9c\Admƶrg{xIRTg0@STdǬ2~Qk?ᗫ.5q0Χ׸R7 [u ,5A#Z:[+yz '(LRBqxH&3&!޲MKR p 2!AKr,./or|8F) 2$sI>5{tҷm"# ]#LғMӢspMthQ=*&ߠw_l Z0R!QX}*{ N)ÝaoW&auf'"[*\iS C}ij±pXE)u6-$%a :Dman<}t6͑|#P"AQ$s;"1}|MOI[V-L\5wo+x* Z M]Ӓ{,*Ǜ R;D(!S"ѦoX`ڻG";QENt/rp ʬC19 ? W0]KcY"kEֻ9*dAAQ1@&Dd_Z()­SG0\b'rETy[{Dbq 8k\t:=*yq.aD$akP {&h\eTd'@Hiy::V٧u $ o#rHŧ;K WH:St9o0AJIޝqH/*Pq\ )BiГxs1WDFD[Lj ܪb~Y A )g(Xrhpӝdh`$mfhE1J@fSq"p5tIldXbEkQḿ1xFVY Fe'稝(K6mFMzC:22g*'47rɳ#?n4=km:7:yyځhq:*o7vנ%bxTa!+ / 5<耐bJ(AV4HqHuC8ʈuMMP#"}PU4jPݪ"XiLM^A[h A$P$QHFy0A^q6<*i@9(-P56>54`zr|8P?/{D"Dwׁ^Q`ä@T=gSs4 $PdT u(OGΈ-e'@yW!BQJ * %!!)%@qxtnhBџJ)&"4*ڃ L$UxZu<*x 8UdPRsk\UjiA}ne Z`([:P b9Ba[ˬ8E3ڒJ JPSa<u!19 TZA9Ez -kAKNk|hQUkP"<}ho5Ή4 $AH9# & ќ5$d4„^Q@d&DqM-@Wh&!-@L\~Qۨ$P!CXd≾Y:n$2P ~wNy{7$᠈Ohdi v1ȦahWz-V^@|6$a. @3c/V36[ :*xiU= xNY$uUsGCV n{\`?G' U^sD:|A 'd&lF)$T1M y~fpm¬%!g{4'(׏Vïlyej\Zu0xh4AqT! (FΔ++ūi-l~P} " #̋1p)v$n*Tq$@mUʝEՓ,;gf-DRꟕ1.oCVC$giiYS $* {ƧU?۟),xae[)ILȹ4Qw]lԿۄ4^rTH甛rPړ$Xjl9m3B3RMiO_2eǒHR|JxoE@ A*4 Rl:v%̕jNV6C! X2L䦯%[tu)bW*H1ң/*& !ˊAh#ΪuRէB }K B8u' 6lhBrzJ\F%3[2%ɎNT'hhé._< OƕR-,JcN~UKcIzҌ,@pA31Ju)<AŹ@HLLo F:=.B "V?OARxܜG8M~|̣57-ۤTmsOר H:y,7O-HVJH |結yX_sOY6^@RMNFGoB>.Ј\6K|=U}û'0B?S,pCNJR.C=uIGPBgJA6Q.( To:ZM&8ʓ&JH"ā"le7U3$,'FD$c ^R&'8hZ4,6rsDQVX B 8&oyAOv3n1WLB>_[n[$T; %sI3i sݐEyMk 9GfJ6'd"~@p,1R[v0ƣbi{h\gk'Lj*6^ `k*Qt 2KS^H.c q2La2gZb 2P !1< ڎ\qG©˓B1Nm` zfm*q{nu O*qL 07(^%)43)KNakVM!;8l4Jby'cHs̙a:˅+!$8/ʡ[XѢSQYBXt@um& 8ѕJyTޠFԢđP (-ց4TN^5AM'[t} _C"o/q3D85-o Й VV#mqiVC$} >}/Z#)~T m/, #HV5&kMBLQ I ic8 -_bҐ ϡ"\cH8YcUxieԤI3ǑYkcAst>(zM8\ E˝_UKd83wN-8bR 0,*(OT L6P˿>etebSyW}9l7\y'!~wi19.Ms #}$=Ο BRN ϥ<'l 4('sT!!Z&hpDT@"BT s-FJ ʡdcDk,zlSQ!¬" @CU?PQ mNAY m@$ws,ȷy@O@!Y'4%B̙ơUk@(婢CQ"!3 ^/4 xТ mjDs}8uz֜>bdn"R?:j~(n..Gh1oi̇A˳ʇS>nI 2 ź>bM6@%._ֈ2HTI)VDgR'B[޹u{3٘rD*8 "F C7/5ٲuoJ|ȷ݇BH֚Փ2yl*) &`p3+>)FfI4oN9ִJT GPSZ^YM}#UM|Ʊ`t]sVabOQA/P8*n B9%%p{ `ӑ N'r7>M$JavLfD6@9 x+\0^l +G1i4J jD6CqLțmԧbqE-a 'Ç#Y;jzǕCkJ:SSÕ6kx%%cIqH!ٕ9q&IcjBǍRbn`};L"n˸gd=(}Ϧat^~2})|2ⷑ8\IB$dMwWLI0LV2"6"3ʯoЙF]FǺR1Xt\ytȯ~mfaJeȺRڭg 'ְX^tt{x- tNvk4Er7yyҌ7xaS{hP6J1#s▧ 0gEi_9<6̆č@|M9Kͅ"|VِvuC=.vvof%xv'W!X# Dޕ%+%,RvĦӓiy%_,?ޏfl#C#O fU/TYk9hNSKD"bN!)TNQJТދۻa*.:uǓ@?n>%eU}SH:fqh^Y!9zZTB\ x*0c*HH\٥*Bz@> l É>Bd`(Of+yMi;T{HmZPO̝5H$|{מQBnFPAQ|åa&n:%#1&c}f;pbrbI:Vrф:\Q'NU)XuրO #ֈ0m{ij<j~4(6yJZ~@%r ,۝G@ 6ţހ:̫i/J&F@iJD nIP`QR{ʋ:g&PL ">>#aHa2 hah~ Fl,_(Jd(Tޔlը|*EwxhnG[!$ ։@>L!Bj!u(NT@{ڔҲSuЫZ ۧ0@RʀEע҉Gb\[89*qY:J2hmPl.GB J3_J$E  M+,4=<}i)(*@/¡fP [S1P;~56LUf&gJ%-9Dƈ6D|hTDs8T!ţ<q$xBSyP iP\1 ikP#'uE M=)2tF a@s>~1Gad4I46Mȉ[x: !)IRn"l8𦓡q*xk [#%Ky($&H$Ɯt-ُ6.ieHu0H2ݤ&M"=vANvd"RACWFZ:V^DcK)S9SiSK蓱-j>^NݞuFnQS(=W$bq*2-rd 2ڼ)B0. [@$i,1%J@Ҋ`h.)$U88_pa * '#+ed[kvN=#Xu_ˡTֹ BŲ},* ǟڛWgmE%O-*REjf-xțۼX|[ i匠fmJس!l N#:ֆCi 9TfN4Mׯ RInYa?mCdmdNIq6{osC]ZWG6pH(/FG@~& $$N;W-Gt )_f\vB|I KH4X5R(VwwT^3+h:օ%gϩ[Z~kh7y t-4{o'ITVdF،2ˌ-di 񢤚$읰q(p JNq *COvhx DB%C먦S8 vJ-<c)5%;򀝎8(J3e t' &iV3[$- LթE$q[nGu}՞>"gͯ8! M8Ŕ,i{MèsZI 7qh#0#A7amc^1R@ x}*|ludeu>*Ө)7և+K!mJĂKfBa] ǍJ=z^~Ŧk!1HrZW^;Ow*~Rzƛx_V -[liIj71"&6 U*~_e!+l6}OA~`B0ؚ╝՞O s׷hߨ=/ . )')Lۢ\k>igT&K'[^Ϝ(e`ke\E > Q I6E_-!_xL%J$I*xod섦ӆHy 딓!*$͹V D+e(.:a~|M HJRKpKxthE7iA614a>y ۨbڠ%t) Er|b?VVۗ+꽆QTB k}lr|Ev9C0i9T)Dr"ΓYyUūøOe<]RrZϓ "&rHTrX< RIt%J{^BT#Pi{.QPd8ZN3Z$EncS2V<$-٦nN0?BsJ U\W'2#\.@fX%+,cJ<`^S2}IP7QfAЬ36:ӡ|,?ys*W99q^x=&'Ѳ`ڹN-T@7D]\Ev-uBA7­J(L{cAD|mF{1Q>ThV)M-ʢ!I p?WBrf{SjY$AһcnEmQǭ:~ݷ6&&Vlʳ*l`٠=ke“s+)T$@Q8$*P)&et_נ9ʒGu:'ҹFï]BAMDCpLi>s: mPPyZE%2<^K55"EB B &LAK6Cv*ח֠.$soP"d$u:ҐKLCk@"tDEe)Я*8yED:PZ;قcDS+-D̑Pb8D!ֈ ~$~SqAKʡa ځz J2PV"*R%CȄٛξu(ȵ :VB T;-ȉ:$:ߏ΁ӎ5.Χqz,hoBJpC͂lM0L ֡cZD3P!Ы&j S #@$W&q: <'/JPQ(xT! P҈-R8ޔ"pm(nD4IAAGRK'SF{ Ɏ|hI<-B #EQ6<,`\@"y.1,kكMniΚ͆Kѐ6ZAJT,II7(eT6*7H9&R`{Yô3S >{eMlyȔAZn$lQ8'\prơ7@ed5WΖF1.$C@!Fup@ݧ̋q hg$@hu$\5jU0W{ ;@e]䌼4ם+ƪRR ;ۀ&uz2*%~Κ*@9#8U6Eiiա*!7F֬YdRh^6aaI6h,N{G`y%b t1)3sw8cTx:I6Ѕi#9DP nNf͗H% ΝA7E[x VI pIj~5#C=xkFEu\ 'la?G_u@<ԡZ b;\ԉ}4H<GѫxP.bۮaq2s:KTNuǪ$lĂՕ>ſqI(WuHպo<'*$o#lGˍ.Lzc+,4bP B4`8\{Rm%GZ *> 6FSIJRJ^Q4[p$lİ9ٮem ZK+^mJɋN@LTI|_ߑ<%U,ںE=[!4sNdwiD4^kшcxg;\3_n&xQnwЛ@),´hyH&Kr5uT8qK{ShMZ! {/IPگ"J](pp&lKa>r4rlD._,Ifd#7 4ic-&v[i΂*|M*׀+ճSx3D݂m[M/W-5͙K ;DZ\J4;e TL؋mj MT\/%I@Zf tsZ'0d%.A uF348ߏAëXHHba -ע(= =0Oկ<amcHt7ݕ'ab1=% I92(rxպVX{ЀқSD`"8ҫ_5{IfZ( t2ٓ/40&Tl5;C@,;ˏI,XB|`}^u|4V9f.PHC#xU[u*CIU¼&on^t,ƠD[AK'(:aB6Ov[ZR ~Erxsov JQ)U OW'L8V^V*N~T{G ksLɘuQB:e᭍@)QDQ"kKA*t0H*PX,ANb2ŬjJ#Psq5$9Ѣ Rs 8<AB1:i@-ao*x|0A84=Mb?">\w:~\`4HW `#'bE119O«CmIH3qL`9F`#Z+Z@`p(GB1~ңV YmAO^|+./eE@O )y! n/aΒ!mzjƷE|7d@W#9CnT: U$3$ܧ:I$RK:6r0OktW ľML^{)R'Ds{WCN.zֈ R8IJy ~@`:BjI9us*[4ZA*!8|B%-A(thMMɉA$P#o=Pb*mT(BAO@P(j^˥ 8EEŨVADT!N$%n@Qo:fyxTԙ7Tdu҉y'A-'O.1AЛQDޟZ`ZɨA/l:ځCi)Nr3[ P!HtA" K|uV 7,N8: ӏA"P!j$h:T JtԲŒyPQkQnA Xu4B%YPr@"a4H8  sB}FDtAHNƀD9ߝu]ABNҀF8÷3nrɄ>LT!ʌ>5("puL?Z/DQIPB`ie@ P "H%D#O hg5 OY٠Cd'*2H!:D8H' <PTXi!I+DGHV^dU> e쓤ƻF$ji  #yV/C࣯Jx%YN:'n;t!N$LjDs*n 7N7D$dXp_ilðA؞\ƨ&JC9 -&xPd+ i}HG3`'1rE,G/eBiV_.(q",_$5 'F=6=Bo$o|ϥ`23n%\J|ʦ5I5Hg1kNce )qEpE|:$V5oOJcH5JZd͵;.&)*箴"! *Sw_\6ԯ ԓ|jL\cf㝂J#?f)lp͡I @@$JqYoWB UvR+2TG:ib` O1q>5d0{)) ')0%QmH{5S6Co+-Ұ!@+5rՏ.ɻ|RyE3_Qf+cS5v,JI_yQJ1'HP `rH.fk0t>yzVco`tmHI"Ic]CvK"RR('ߍXֵ[QTM݃sQ7 >\.ElP@ 9U{P7F/VЖQk%J?-5uEs^a؅% ~3"Z@N#wh[hQ:z~d oYqIJbOƨP|VX4JGI:P$[{zw ɕx$ȑQYf,?uPT6fx=HJ]xaDI11´+"Թꊓ閛˻ ,c08jd Ǫ$h۰4RxW*xuT! en6vBeWGg ~+:VrR$ o$Bt?:&',lˬ>^N\:@6Bh9 \g <ɘx6RH9I+VNy!;¸0HlLb:؊Zv%P~̕Bt-2Ot7OH;%3EZъnU8%}rWMWkv]CQm bp.:_˩T%bm!ee7yb5T]#C / N+je @%o'lVwga3OSjy/R$0q.* 6)2^$W܋t;eQ!BUu1υ+m T=Â)+SL*yfpu<_D7ZpiMl8yDžp8oGqcGE*ޜp[,eDÚ\׊adWcwVKh/UL%$딉Vpo*(S@IX PQPwO3RX:Y, ġN!ie%j AI A֬Ǎl )2 a 0+xwf\Lݭۮ2.y)n44&{@*&l(OEG0@`&&Dq*X@]J%8vbQbMƩPO;Bh6轀$-$+CҺʤc~#ABS:O -RY#Qon\WFp\̹uc\!^8˗4Ax?w#ŲrBxc pg t`2ۚIM٥VV!YԐ*Xx ɖNL xΓ8mgI)dz4~F͙&:*ZҡO㬅2fFcᦔh`H"tҬ|.M%B)0m (~T m3b&:[qQS<1M rgfxen UQe-I)$dΟN)A.IzxV0fo֫! 7X8 Fưc?S'Uk+F@!*ٸsh83Lpq MD#@%\h k-j@"L2 JA94ꂢ/b/P^{ "B R3jeR-N|Q3޹|" Xn*JRAT [ʉdDHHx0ҁƁ-"62AmµPPQ`HQZpo"dj9I»&.YnsG5NmǺ)7' @>u:O/ CMٹ+zfv/ mf[M:hQnßg?@HIwhvi}_\nCL/JR֊,jmUf4 @Hx/Pk|6UƜ4ӋV(|+b,*aCCQ;V$x {Riwh1R³w U6f&%]iI3L=lKڛmX%0֫QBiDM;E:TgCF4=6 "Hcc]I' ?3C7@gYu+f!u$0Eͺ#XJUlr͢8kL/ .$e74Ҝx:k{H*JӔ'fsrBNI&S/>{Dl D:uW7_~1 )_B" t3Y>Ta{:GSC&XntЕ,gwRz>'f˝e-+zҏf (GjOaN`OfU=Df֨OYÐC\"/"{q6XHJ@ W9vhJ[5p&- haeZ|XDY(Sn^xLʡc0D8ZN(;z`)3ZhkN 3>%C#Gz@R>c-,R;(0'š)ڴݕl ̓{Rr_픷Rl- !aIB(ڲ㳦G{X}t)Z̑};Pt$\h"ZEI+`{-^o=-a !ʹx[IMbHVR`1GZemn9hP_†W`OSUb[U6 -@D^ ]s4?A‚yӛD/;#\8PɃ ̖)P\^gh q V"/V)6Ԥ?>0~5vܥ;U x,C"2.b~TzD@yDlj٧(v="6"6%ep43ͭQjL#JXd?FL"*Y-d0nwik"mD뭅Fn 'ǝ@u)2zTD S@L<N1#%R20ad20ʛJmYo Yu8dU@o٨8PR8A$E ɭ":3SB@APu4 \'::\l"̂ccAJ1O\4HYΪ aӊI(qh>\{2%FoӋ ?z ؋ 4 h*P* J{<2LwI& K'HRNaI IV\2OˍWfе)YRhkiqeF2h-[#gu-LL&=EZ29'Bjle w~4Z+"/ :*{b?#T12yEle ֊ϙ]$e*ԑyG*U1g (G6Jh [#+L1lP@9E"6#728gxu?r$mq*} SO#refm &k/iK胼/$H1#Nf׳[`l@ CO>". $J1 fʂ3D+k`i= uJo*#x#s:38PK#{ '+k2 ͙J_% -qط졡ԁs0*:^v_:VbѵBy ߏ gtY<셔8𭹷 },'rkR1~ 9҈($jzkblchap(3-@J=Չ2*G[\@:+WR켖-mj rFbC> 5}WV)W쿓enn%QrBu9 eŨ&J4C̼`d?F{M9B0ނO?vh_@df@>iV;m^7h JIg5#t :Vf[J;G$6s L vj=1pZ6kdzt{[z-J*}MYNKa!aV`Mx,&kh-*i07%KqIuٟ.L :ijʝ ri%_$k ֪=lxFt 9àMA(kn)I >?*kZòRF$P"-(i:Puq3#YCQ @AG^<В7ơ:X ntQb?g !P"AZD՜t4Xk1.`/!>Rbc Ĩwu@EZ#cZI˩P hd7IDL\uDŗ/ܸB&:ȤN`$!< $7Ð rҮ"HrMy <T$d:B}wy`ɪ9 zb}͏y͇{կ^7KSE㏑@sٖbñGV v;Sx\jEum@cS PQ/ ׇF}(Qd?bD@FSD9P%ٰA:A H}ҘS6h-JBΉe 6ʒ ̎}(u]SB!@ i8Ix6h Cr R E(A764y.KQԙ$kB)@ &g *u*De=R T %s3i@# aƳœZ*JZB} )AME :]}(LPO>KK s`4|$ UVvm^$vLr6G!Hl v)sM6%eQJeFd$XgP3I %$%2TtB|bMs. WmںTL8)"z oP@gk8 r!i:rgYJ[awK hILV&t?J94`pZ=.1oJ7a#sڪLx‡&H}MM湏M=W%v:qrB?wţED{8rFO{B9qC*߬rĨ`e5ª&9ڃjr AVEM!$mm6Oj@*I#4'~?HC@%<V2T9tvk0CJRyZIkVke3NO]tffN/쐥&ú9ګ"ax\7y_<:aads%J+z XAP'Xlom(iUu*$8-&Z[ q &NgoFBeaTUY2\AĬZfI$Z|kZ)~Tyf$35<M-҄wg)ė/ܸ2@f4ss π b;iž)9X¯\3}+q^]&b!@rRG Mǥaɪ|4BD"yF^Z`L4țĥDfǥiƼHNa cqWl *>TP*̏SLԓ?kL3#|1ѐu\PSh;5b4T+(mAbATPJ0Ɖ<(u(PrZykց@BbvB:k@#w?Pjp*:PNq{{DwhsiP^Aj8_ƁW()ypʠP hA$iI 5Je7AIHPV`Q $5CcB^=P'a&@ iw4ʉ$PnkT"iz847A̠ZvyljRa:T!kDjV[Rg#3-]*|%9٩9a* W8q 3ұ|MB$J` ZIB!|9`E R/8M!g҉J O؁7Qӭ@DlRF@a՜@ l(J^ 8ځs;CˆH"A҉.֢YÔ@J{A޹@d,Ij$v@1P D$uPm(a B:ANJ`BČP$:`2uYxB? 7aP{K{+إDzdŴ Q3jLJ_:>tN y)^}h ăD(Jk#c @NJE5HPK$6 E0#SΘ˙¥BJ8jP!'b}'jW6I!?RtI, j[YP٨DVPdIA-)ye G d r\ɚvn y!rl,ۅʝ L' MYK[wڮdED@Oƫ+e-M̨Iԟåqg-n͉R݆{ՁXVc,ݍKndB c $ԡh+zV׈('Z0 vK.Ŀ[q7w܋Jan/gcVÝ]j #W(S$%HeD{7&d5ҟ5xKVt/d.=MW,TDXB.T4ƪϰ0ڋ-;}uB)Œ$ȂyH è@ȣǁewHL4|R_%dFUF - L Y(~TE.葁>ҏyWL&GX2Ӎ]Ď͠,*kZ$8P~3@R'B[e}([9|쫘#:hwb/ %INU?Fp$] T~ ]څGçp򆇦jV+eH?U#@R*^_#AQq'* x~ 0Նç9{RNPZ\"] 9TT3`h?d5^WЯi1N˘T$Φ@}nmOp{̚GƽLZմ] *JS"I1au42OJ U $elP9y m8Ԇ0Jbcʭ~ A<¶hf}"H:`uёV8<fO|D)$hC㡭Sh:4ŐRH6 ƹ_*!YT$oR([X6ڗixDr8y/|7<q%6=7~K{j51gg24<8iyh}oFP&Oˊp>t0ϒ^mٹ+WU$:tjZa*UMpa ld9<`t񃓤+E^IS"O 8f,t4չO,PQXkVr!nf}$Tn5!͚\Y4i |ɧ(D8$˥!Qs'nljsP";<[&b3D~TBcU^T 9!Ԁ n"Vk6i8$sz$wX2ןV Smf8-] [E:~ɮ*7)v02u@9Fis[| 1%$) 6= H+F)%-?[YWyW v;G.>Cˎ Rtŵ\x% KT'j^0٧>&h-5:EC$8:3FZGG7+oL vhZ䚻Wtd_KÆSEb[EP[x!!.e)!`:ƥZ#')p ҡIC N҈(sgl7.ŎEkVc/'18~ӧ$Z#* F!,)|DT߀Ɨ/޸Cȸ<hLIT|8m'Vǒ·D嚄S߷u=$4oBrzţ°dŬ( X~f^%0gPHV@eԦgV>bR0Q5 ƚeGנqΑ79EUY7'\qM1.863,v$%L'b=c7cD JBP\=)iXpAZLӅjWS-iPdhgƷ"r²ZI-)$ YTV8,Pyל q's*Ti_ Ht%tr5T2$AqqUiT$' QOP#)] ӡ&DHʈ;HEL(u7!#Gx*cyڍ>l%%?^剘aZG˨V鄛z͖Z ʉ){AViSv蚯i @"O9/{Ӊ^O emW1/X!堵S:V<mK<7C)WPgı`l 6\Ţ4Vb,:y:ڀNSԁnd 3}Dj@C< %vDoJ1 %hHR @Vg^΋l (j"GYx並2co%%o3/=mā 4It5p6̮pVb{5+y%'RUemyF$āh㗶rCxh %iʬ$ e4Gof;l/`M HJ@Ai(vMM[vXlj\s\]~5L^c>NYp;DɄܑJ%{RFBRTJ8&j[lWC,@3%JA`NS@-Eڶ3dq.%&'*@rqPG7 '#~|&LNѕf~Aaœ Hui)6PƦM:SZjiZY\܋% L6@pSK![l!٢efNh鿻@h )l] &r.Zj.cWV'6%X@ I(A*n"s섴ӻT%ˆ;,r>&yݓrFyIi+Y$GJ޸S1#0>xZhǑ4쁱vJk 1DbczHHke%IKTm`D|N_Joۏ#IlGyjPQ$#!#]j䴭LFb>ާ-C}Da=a\AEYjJDrGJZ2VRTqPΙb\UvVXtEFx6#^mсEH@RV=ՉΖp RPBQ$ۏih {\A9Y3`Dž.=⟰fj8vrPAÎwr?gj*w-!P1>y5J7~BBĞ:2sfc-<)@qA5">T+ *`hE=vwq.ELgPRx" P⒐`LH^8)11wi-F1+?9zPV&5홲ZCI)z\I=NT˰h (I35=Ŕu0v(KcT%)j;m%H 1kGwCKaaǖrsCѯ¡9CQ ?PZ$rHt je:R0aEƥPNPO!Flr3,x9Ԡ}*T39`Li}hA$hb$zŎbOhYI+ogpn!8gY0%Gj31;K.EFɒ,]V9qj^1,oD«Ӳҽ{u>08}79V%X 73E`Ŵ2݂ҡ@_JZ4v:Ԍ2n&׎jkwo~xFVՅ< mub*9UnZ6[5ОB_Y!饺ODTp OT !~2*>U++7rEAֵH> 0C֧.O5&89 \74via=m c~^rh>˞2'>5= 8\X"?qDHZ &WPd8Djlx*PehuVQ\-@#*\P$k0a s@<LA}$=M@ < CLT M@"DǍ xqޠH6J(P hP'^bj. "ɹ^8D YRcZaEeIP\T@'J (T {i@'uB L po͑RD%<؃ 2Kfjw'P \cZSi}h`B *e#V"p{5l_Pӹ¶A@^+iĚPr[_ZH4+;ώ2$SWw 2?1`,<rgj9~T!ʡ.c¡^_7xi@'p^2$‰#@ 5*@a,8!CP% ^'-hY([/(KDt҉=y)ր\X ӈ3cQL%k#ļl z r69p09)38Gw*:ZQZ'@cZĨJ0Rr\ ΪAa?z Lshi(k{qn(⻷<J8Sa^E"@:W4@4jڏwY8 pE=|M Wa^2S@tj{PIe\lcv>oh& |iWUECGgBf<}j=sX8PXkN2Mr{C7f\e%&<ƥpaK7MD=M0 ,|iedoaMp5݁˺8ָ/-$& G^ӆOE[JE+iK052^LpE[l3ser=d^kO7)W@yG:jd͙찯 7.G6vZlfh9fRŒ#H.ɛ韪ATLs}}3R ]__BpڭfրVg@m:j$ 'X/Fk|H䎮5S{=@KIh"X@|scVA|-Œ;9@3wTGɮff=lz燻O'nF鱵SfW~"JS5Nlhwc9)ZPcUZQѰv[?ǎ;ɓJcol evmi>5̚P5i-d&u9MG,[$V̼ݝ{ R.|Ef/9: t#kA)xjn75 nrShL\tZ0MSqNJ(6 )J̥FItޖ|n+JeXeJBTR2`i2pE+zB$χH4utu/a6#7w%*a0<{hY$ *ZT<2i91tSa-- Q FnVl8Rڲe!n,(<{ m'4ԭMeA+2 ¶I]JlБHJRsv`_}dIYQэ=KH t2:Vd豠ohs)J[RBJx(RtpEkDW3a D("En~⸀j΂x06A)7 [[J[3M\5Y}jh BsnRV$5|1ʇ;Ez mAi6#ǁ[NP'RB)McHÝkխuۢUUs$+Z:/ *ջz s,GOSz*mq{7d/ XOM+M$:[ƨ+aL:_I8)] { ߼[{D!䄩mֶu[}Jrns`C*JEФ(H$қ$"r^¯yBkF(.UD-:Hچ_RݵKj )ZZX)3yKqъý[.BPT I$$A y(nC@-y c$@_",j҉t*mj#*$ƚA5_~/aU0@*)tVEh@x_Bs)q׊דxJ ccczMHy~?SOBI1؃~_Ыܣ ~UW| F_`"u)4H2)v/LWd^_JBy7xmV{3bUm-1W/-%C:ˆaS:ьul `!ryp( vԩDzQ ]1cj`zq5,$pC$i@$SA*P'Pi?jIP)<&-PMDOUYQmt9Zc*~T/85 _!) IdMgr%6 $2 걊)QH3r4f[K :[ʯ%R'6kiXORj@(wZA:w Q R,+4+u̹wPvq(%^HY}K]l0 1$+[ࣅxp\l^dm(k9h=1=c\5aT k\PPA'Dj yQ ހS$d8dʪRRIʡZB- ACk5B"5FZͼ:jQ(E7pz LJs4:υB uv4PQsP`x!u"Qܴ2􉏍JFq-~> +tAW!i>ݪA5q "|j!/~Z:[ ۪uNi!F4~uJݾҲIyR_{QVRJScs@"/(F!DDw;'n/0tTX7}\A&4L $<y`&Ɓ(IDBƌ,"d!$϶cp^ Nwj%(ĺ3$W5NրOeB9NC",ENs@fH>Uw6a&? *8iИk͓"$fZ$[&hb }8W3;x':u_'&@|9bc>"2BgªB6 5c)Q A,!&r_MxdVGK! Ƶ[V`L"f6'VT!;sDby׸ #,#DÒ ˞I.Z-wm+)j:j{Of87Tzka85# @х RIE:m;DhޗeHʩc(wt8ڲ+!pRX8U(V6\Pc/R &./#EZVnDQal40T8E9+n2vYA)å!*\e9A^jԔ9Fue&'0dJخ}َ<1l%! '纋v8R^LDdh$/(`͠q5u ^> WBՔ@p*$1q96aAr#- A Pє4 .@e2e7Ð?Uk,1ܽ,UhP>u.=.|%eYJiNI"OXImMBcӈVNaSR7w]bAG kn7*rv{OyHҦJ%\&J=rR dO|{-PTOM99Nc iC#(;k8^BmgRN@$A6Q4+ŸVTaZrNt\2ϺEswfm'Ucۀ݉. ֥TUh(q)'(vyi"WޤG(EsJ3~"h):#M;\IyKRTePNY:tCuen)XRG)b8Nɴ#8 S)NP\=weWV-k,^A8k5)7+8z?ċM0 "pec"yPl(E} T Nh[0LB՜l|#v=P ΜSFaBijC˝B b0#YC y‚ :WM7M< KSP t@!oŅB /^cuB S TL3 |{]I@&G֨y*~Tm2yWC?̒&=+>_ɾlt"!JHRɿf-MتER8ӕ$5%.CTT!25qvB"EBxPpf.8R)H*2$ d}D$yDaDDA=hidt:au@AHHQ8<MCׅs>akj08d!~:ciˆK$IL t m Ya¢T KMƆx Nt7AlͿf| J Ɏ@vhqV+Q?+MΜnI1R-rbxA?*P  Շ8WI$a8D"4uFfPUzxؒb0\Aԯ#U;ۊt0 B:# ,0I$ψA"y*9jI ӆBڹfh ޕ `,H?a^'$= 6{wW]`|FL1?ZuAY;GR3ߑo[RfSq6DjH7'HUs$W4t ,*A O"G%sBfcNo$Df8Ӂ_5Mteq|=Zy< [ .qYX2~@:pa\[V¥@Kb co1#ҶZe#<] B-IR4(\ C9%O,36ޗ֨e.EVi:Ql%Q'"xe䣬ŭV)z]I5JMy p@C]c&ݔնUl2 R<9U_>Iy3F:֞ RPRnT+$=K] &̩ʺuVI\PI %ħR O $\ 1I%A%cHM6q&bQ5[{D+ud3[fM%ԝD+Dѱ;EW0.,S@H5i)Ĵ: ыk~r[(.#WnܔƵaMv*{DZ}<>Uf17,H&'*inưDČPI%''Ν엳r1Ӛ TAHm.Kc1XF)ʐy%[ZB*q$0)؉9&,'yq!ZAؙaC ҠsTf^$Y Mi'0|gƴMxYTy=lB(8f x0?H*Ezf?7[{;ؒ?Ug~B&k#/gD6˹gj($؈RFq uhthpT'@ H$0+xMDF>ZC׍;ӘXDsP+=J@/u]DB3 $!`_Uoc̿ng?bcW)QR{o;9Cb­֡yLx$m!)ϝdoSܹ*"iXD6 L( (uH\8!)7wӵ9JT|ő6PɴH5/o V1ʝXp/&flkP 9/S(DF(53DS8). Բ @zޠ@G@0@ w}vA(Fo-P#iln3>4lZ%#HP]Ah)p:Ph)XT Fh+m*fH΃ Ae@؝/P#e:QqG"&d@AN-Jb% ~7dNZԲ Sc~~4uNY3ץ(FQ]=h Wy 3H~5_Rm T cĚGgfo2G $f W0*AW Ct>[êE**P^i^v'@kk@#.TcA O-:ؼh)%i7aJǦ@tB 1P ~T!D:l'*ŜFp@nbhZS!Р TơSրEQ4HqIiҌCI$(IVKӀ vN,b(zWW &)]3Nu@$|:5([_¡}An.*$pvƀJ^\#Ϳ˂ٲCZ~FvJp&DG@ P PVD3OoS]Wɑxh-{Uɳ`AJGH56(mO$kǍB0jZjaN-\->W}(y>4@py1rD\UB:()k e:ySI=)IR>@'u=jMg@8Փ@Ginu@)@*`&Z-zPT!% L @s S 6AƘ,Aˍ@-L@aejuDǺ4ҁqkkPg]9!8[9"Gp E+" ҈F1JZ&@@%AM*syLh'֍Gi*'6KjEܸt=kaVR§e37ݏd Di-9 [L o̶f|Y~!$sz 6%x ^i@\H/chjan b\9G)U n"ƻ6W9xHQ@$-tb܉XH93?4E'{V]s'dTcZʫG < X)BI 9>鹫t4TԸn=BK}Leo=ſoƍK%1ZiaM`}h4:KLХjO9~{vա<ڔÿK [Q?4O<[W)L?_X,U(N[dAQM!PJ )0N.2Q+2HQ$OCL :-MLڵ*EMø xhnMx^Z2ۿ|\GV~0؀ ZA[!U6XaE^VQD؎D*`j1r˜Ql Tё h"tLgf5YBpq6:r;$M '^I'/Y;K[xQl{Uy!A*#\X\+gZvMeQ;E1kai<*%cZ J#IT)eMQk1)_W'lŔ8Uxޝ/P}|(_:X*v^ ߥ`+5U8~VRZeeN5'?mOX[j^RCJ8pɦō)A]GN\Y4$T]E%@bftQOI$цb7[ Si<6y RISJJ2 >5 V/OR:(]}X d1rI'AZRT퉳mMLØ-%4]7!*T OIn6ݷli:OXˎ H*fm֡G@_j#f2d7R88TQcpĔ$$&ǼyM^mQa)qjasLTW{~lbFUl7ՆĐ%GNq":aZ1tX~8KN(.&D`bӧZs]-ځ9:F(yiT[+9$ X EWR6 $Z D& ic/'> }oT%@8D҉6¡0l 2LZD@$w]ź{Vr=uFI!y7O]lNj(!хPb{8R{-c ݅:B +։RZ *3bxy 쌛&˝rAԒ4]FMswKöqrFѺ.iV0*5DɈ("WprJSڀfDcJ*j`bx*b@-, ]Nk G]FҸrVVŏY6c^W5io!heVÒpgd=kyQlr*:UDPre4.kGi~"\5Jo ƔL|*"1Can}2VuI":Eoq>^jUu ,sIZ/5!oI|A8c:#xjoK;!Ĵb$ߏJ NJʜ'v6B2lb4Z:ܐ€EK|*C:sC0=jm.(hOPP/4,"Vh'5<(O* CssC@ryV<iZl` a QmD$eB zRXRxR,aRyahwjmؒMJ,J5MK "oRx@A֠($5yH1P#(h!>U$4;bu*|0xD dԕQ@-c[0lϓ3mD^:dnn8%6 Tύ뇝5U 29\ٷ.eeR :V=eTI=rGBd/vR`X+ۅo$+ѵ2QAI|h dmpWUVB`N,ÇX)}'4,>Jtsqn:/~`B@fju> U2/R+hĪ@ۭVIcYbU$9kp|ǒ^^!ܿFnHm֢YK8v6w0LA$_֭^J@Limnj' La[)']/ f LuHu]h9jb{hIl|QMSkcaέ0d> *lj8O#K["XiDdEI[;ؘwPGL)J)J651E&[vQScQj#&37w %!@s+1xSlldaOe& Ƶ mP_2_:9'eCQmuXč!<(6 s>J`IvMmL8 XB;D `䍵yq坓[я/{8]b&J|ȿ[Q|g1Z+~b)rEJP {ǩbmxbikY rk\Q{V?(R"iZGrOFU$بuWwE9*\Y-bN]c MR$=߲ *QRw(TOBiǖ mvNlS&ƃĚ0[ 7?86 gvs(Iy \ &X53"Ozoqʶ*vCi+RIOy" JB׼*/Աܗ1mI<2IrLn9)H4V0h)JBx^ ɭ¡wb1G  u*SއNshKx1N+B~ [>2Q}']X'=$q4[x>0sEsM5.=\}sȸ?@)iAV'hfZ`!=-d)_:d|G#VTla R +ظd9x+ skU/gPۀRIO>+"*Dvch[J8|j7tJyhrqleօjp;_Pfz鐧2A:{. NP,arer}+f,5)fsN#ٰ!Yg1\L[ÕR8F[M0!: :!W:TIQm $,fר<0dxT X|!ύp44q P0Eѭ !&7> m-4HqLRt~jgWqP'lQJ YBjxJk !uG5G 1U#cA0pm:T ðz6J2CjT믘@UNdsLU|98 mV?o)U/*v-:ExWڒ@n: OwtW1X݅?#X"bIm4茡'˩L3Pbz1"*EU:4]*BRuI`횣]@7*-4>uAqes@}ץp+ i$mZFg2lZk~CB 7aN-MI t؃Y8ŽD 3RSqy|YʻG=Kz4fl@gi[8s5ːN҄} Ʌ~ՠsơ ONtaAoߍ J:*::!$^g΁) \yrC&lyQ ҜB-1Θ×(R5/@LkPf#ASr:7VcA‰o C%mP3PTjl AH6 IlX(exP_ڛWbuKVz(362KD~ДUfe' +GKW6QI5#8A!XS KD~Aԣ  OV'BfyV:!H<]$i]8Y:4$JδmOƈ_Z 9=hY ݼFVYRBˀ,ր/ÊDM_|b.(qV2  GJ2FbLx^?F2ayɲG]NFL 0M#gt O>3Xe-NҤI͓H҄|T!DEBu9Td8{Pb)!Nοhv,z߰ۻo19_'!],X#,Vj4% "?sƹ/}͜D&Hyd! Rx0/j"ϛb@3QZ\AAPY6:|jU*8L[* Rӝ@$6 +)"@/9IyԕDeS> huH'f%M\LoYP踳inS6NA%%Q*׍U2ҔB &j8sfnXrVx7\X%R+͈^ZArԃD`O:pmxX'Ǹ@$kJZBTK7hOHRɸVq@Gj5ZE"M~qx!(i5 b yR#i :cM~8]|wQ&o>RK5 }ngU[&Ҏˡ5Fu]@h,ʦބy͐ V k.'Gbkcc,(8AN-_FѫTؚccUM ؆q 6}ǔ.&kGbkԤMb |^HxyǽiY(-MbE&G ha "}ُ3UfA** dXbN*>U{guם8̹C]L  SGDċ^`j;@]rHoMEmYqh MU9R|u.i8l"1$JÖ3"VVİiŭPL(0>t ; 9$YBpnUjjص?bk!;P(Bl*"JUЮ#/ N9.=JRL\?hԓJjya ()cIO*WV\{*>0>t[nseb퓗>x MMGe=Quж*QY aV Zy &"W"A+FFP¥_ thxgPd'<ȐFoƷtuxF5K{\^dn\o*13w^4fdfƳq5/tkăv_JLơhs.q Cno5qáA*VQn8z d^D[.F^Ha h PLe$wOJV0PaO0>(*SIbwțD#ICs@'JB/n ,(vd ]@#13Plg Gt[u\xwnhix4HqG@''Z <<a@9{S{ɻ!?&Y2p. 0":P"|H!j:X!<5{ Uƒ!`9%1B G@#o{xT F&uSvʡFq@q*Hx ޠE&\\D ^RdceP(PKw^1L+c\0@)7B-$#U¶iO<\tjx/*)+K#w>S(" #υ>K"[XcޝYY*_Xbp<Zvq2"DMDqԬJ|)ǼmyT^)2OJlhi;s²@iPZ|҈{c[Hx1&, f+G2@+H LPHWcINw6~KpxMuhU;OH:o$4ݨ;ܴo"W코` Z&?vʔFjKJq;Vq{- DokIS䥽{x6HAo)bU*/O,á]"MVbz 5D+ }׎Dƽ}+Lc~VCy@?!`i&>8 +b&;`fc1!^;@N/&'Ez+iO-H2Cd:߅[]DRan%!w{`2h!|9rm=lFFF,Y²lÉL= tJI.UՂi;Cd-gI#NeТV]sO*ЯS<UКشo)J*b8GDOZ}'g㶘 q Rsck:Jc\0@VX۶^i@#X%@fAۅ4Ee٘wHJ@|BQFgKmJZ+BT Et#򑝶TBwv"lLLHUVIV͝ $4%ٸmX@:,!A12@KfRڎ$1mmB$JQkM Xbb`=DkNJ] 8 zceO*USof83RNqE´bHIE7ko@<WvLLo`ċũ`@ Ρ %8W7Ր!eMYqp' #´vJ7܄Ki\Hқ+m5(%_߄=OKUcESt/g)T R.;<ұP|BQ@*DSݎ9QF-8T,)z_:#u-b8%<8RČmaIv)'r77fƋUq.fҡf.*=uyD ֠ĕy ޴@w*:;wPVEBD1)YBO<\@0f`D@ ?q@E} BqÛ(J!%$I+Z _ :OyT $ jHDވ!N5T PUO(THF5G1&#(NtCəϥBACOZpaw}ZߏSle~8/ʻ|ns1)3Z7eN$BIGZVf+Ʉ݈6=.1 ׍sDF(*fSfT!W" 5Y >=S RAoҮPlG$M69GbD:o֧tɭ `[M ha3'iMhm[~o֏tɭɱpiC`ֈp4{MhHN WZ&$ p|hwLV1X'w2&-;ɇ ˉ҇u"kCnoN71Gd{p9X5o+*O5Sd֏#otX5m?Xp2kCۍևvɩ xԭ>0vJiCdԄoPèwqT5"'iQh:aՙ@Hy&mѦ!]S ƈKǧX8 '2x( - `D]L*96d=+٬`rd`~P˄HP(G63Xڊmݑ lx}ۂ.U][2·B~jS:$ï \Ga;ٗb5u7a̡>5$S.(_pR :f:Ց|4SwnSAILjEQœO'܃vzv$%ԃV*rxbEj-6f%9HM%*s5L%ߢE^+a :P]n57]P%儥bJ\Xfx&t4|P>JZ|هQҸ\ׅ[K٪Xqpg=<cڶ$6)R+ߤ:kD |ȉ*%H) >Ubkx›ҀY|*<*HFOGL yC£A3^I>]u|BN%$m:[(s_Vv/V!IBJD>򹫙JxW5{)mB{[w.O^5?y dh ̓tZӏ2{J ~Mܼ!!WԁX헮 `^8s y!&~5,(W }ʑhJ!VF.\[)!Ii}e;;Ϸ;kH/PLXӕ%Ch:']ɗKBqnIKa Hi#/j٦3;+A75-// ϴ*6`3.5X0a (fEĤIeV8!3Z2EZ#+r69)Pp : ^W_.7l>*T,RF@ ^!g*pEtw?w/#:sAIIgX\7@_AMog,9ƹ?YЧ|3vjGO}~C0EC&xuיPD@8j]7a#OM<|y';%!JUkz֖ftlMNO ɈY2c]YdO Uy? (4@{/D vJһ (>vO 2*4p2?¹fsR5A tBzWUV!gQ+W{R8Z;GZ*)#)!W:<oi>0#c+hn}oݾP}٫&ܩH#ˤD9Q2XrMhdxN l X]%Qr9OθY׈cߔ ;X:ټRpC`}L+d$G$hrq*)s4rI3mF(&s rAH^4VRF 3HO#ksI+VSLy%#IQ%; W +" N>lT4wQڿ_:^H\?"&!;$d^C{w"r\~u; ,XTW4u{G@ίvTx\Qc,Az'v_Uu7zLS[ĔqGDJ{ui?N{3:(b>0}:^uS#9aZ^Z%HTx*h 24[^A:VI7h[൬N?U~G :lyA :`KJxp8BRw%Scu»Uˀb;Udtb2?* 40RSX|khE VHxYE^h5ȣi]\9ul̳pX9s=:bIӁ` 7ʖ]i&ּ [->PW} 8B~% :ڛ# 6L2{-Z[=ZgE>)'ζJzTi*22r)2E]?Z/ɯ#zִ6U)me0xۜxWK\S,C ^q B/x5vtB2q@/q W\ԭ߭d%[/FqCnߠfȘZ[= vV{ogWѰ&DLT1~Ըˢqؤ$ںDʸViЦ^ĢbdL?0Jxp^9{ =g{֡JCm#|uMÝwr#BRAM&}ٖONOA{ TEUa6v z"M\{p:tdi ΒBbuT.lMǩfp6邔۱*O}p ʌu_b)lnckЕ k-}*Ch7a)RT *Qf$6AUM޻ҁe]ad11j˼J 4/u\s06҈!blMqlR k^9gx5$cX-x ~5.eٚ/qS72#5*dDKR 0zF…g[^ +*!jaKk4{_0;C]|kـ6>PȶTB$#پ*#,iVlsuP[`B\s p6 /!% !r>U6M>6TK<ܘf"a)Ql Iu$Dq i@'UXAjVJA_ y@"Y|8`T!!- Ӧ K!rO3}HLr)d2|mH2< (@u/HMƏP ֡#ˆTOgJۇ3s&u:uF#EE ]njGT߄~sUd~<Hw?՞m:W#Fcw Z4avH5:B Wz?(B'1*_%s9IOS4# 7-܉X=`#rU8Lg, {a5^=Τ|nɲƏAY=G/V bvHU,@Z᪽ tBoˈ-VV-7fp:_`Cx I@sjyɱbr~HXx>Rh{ru${U *kOi$[@cN{}֗&1nɆ7)c1V|Cx͛&DL{֬hٛ1 2V_ 炟VM8ݪs4S3iNnCmŊRg555#qU5LpcV1xZI'δxV{>;QF N_,jKa7@ӭNG9H#,q>MM]< lٻ؜H! 顏ƩAfu&aK\ {aA8H: aO)l[xDPʳ lSGB4ua$[ҡ |6!"MZuG?/#eg rNx/*)H \,t1 (ڮsCB6OFuX.fTtDW-}R%յ4dj>^(%}GT 8d6 gaf ̧~*&>c.k66&A#xJI౧ZEoKn-`wՆt:X;_C5Юm^G@u)#N~ݦ4 cvC۪ Z]EN sR*r=dsWx'"|' ՗V0T~5$L+b qBP`>2|WՔ/GKL><@ኈe ^e{1NLI:d2K6>Fh<ݾx\Ѧ2 bG 0jKR!FИj-2eMVb~ަ1t~a LI S&jcQC6M=fL"U0GIT"ao) ,h0jS:uOxnR +NWR!4#9q]h7m7B0zH|At276_)'7Fc9֥~kI{ӄŚn9=M~'?~oh| `|!pwE‰41a8)E$5Ӱ5hıH8UKv絹ma=h5h7Lܛ{HX@(y ގ!j@SE78wVpڸƢ)kI:Fs8!1Is$xiikj3$Ƹ㽐Q2t& .ڭmk2]k3-ѳÈt6zVX%vjHŒy;f,kxу&&o{%e$hU/,Y6)q+:ȈXz nPeSGہUOshovFv"̀:JHέ=[ &u_v_ÝA9O1V9Ǫ[6WՒ Oz⛲ڂnmP+aܦdOα历/ nYivNH-'*2")B[‘mУN=IGAY$Y-V 8T)ny]GZzGH+QA?e)>Vg, S`oj%l55ls̝*ǒZeToU1h{̇$drRc7`^V +6WN)yHWB$hEj'w\[ؤd%Q$?kXct${[sRcsk$hC3ܯ@Ag#bQ?X>gT'#} MxRT#Sܿa AC vbЬC*H*z YA:u} u4fXhmңbky_\]GBpKjExX7eA'P{hm])pqPںiez/s,!A.Dܤ [3{7c`";U~]kN,z߱\E>O@jguvl:G/(:T[pCDZ47x7뱖D}dHmǂe@-(lT;@ t6[%~ SlӶsNaJ]V$'+=Ȏ.yUcdvZ~5)!%.iU W΀F)%BMB:ZPsk @PsZzT MB 7!q@΄~C$ȨCOBAX[ZVDgMiBJe8Ǎ0(xtO 4ucD(+ ;@uډ 33fc L\ɢ)!}0;Dăƶ}gȶ35mxyhk79pq3/6À?P_Iu90i`։+*OAp!`;ҳcٴ]7y(Cd ݧ[}$"Fu ؄dPL~4G#Z"S^x.Qr\s*Y#V둝$`w à)9x=!c7NaMJ rL`ʆAċ 2 M! !rod kEJgs)LضgzpLU/e c6!i'_Or9&FcI&x~ukY a @{Y!Nb̭NjՎHFПfS/4'IKsdPX2 `sHuH;xl)-XOԒ%LPϥF8es_Ù$ կPޜ3"IL ,SHڸ8%&5jةDGLVg9%Di#(OTvcUzHFrL{ ֋M ue{ +;ݏ`\KۨH얂P~t,yzQpE>@g1 ʘ 򣟗f9ʑe9dxu;$X=u~{!P#^^Ti}R<x脃bW7Kdcy51Gf;U'B &:&i>KcZuIgA$Ȟ>/j(|s6 $y怢<bq / X $yO2([n=n؛KE1?h.QO 2,x:lUW+ !$qpkL&JCۏIJ%n,Š [KgZ(hMlZ8 Snt“o\|+bSb(ܐ&xfPZ4L7 \b%pX}=Di"H7ֳ5I{eUCS Haqjj̽ݞwΨ!s%`ZuI(Eԋ]KZ1N>1Z(2TPLzMPjK%] ʼn;äzaٍn>/{px8Jr뙰99YupH]Mm><Y$cqK1/lfl"}"h^c/ H0"):yUӛ]EQ,apC)jGJ!흔AVP (&dd0HZjO8:+`&lH4 a\+YmWi'1 [c%WVJ %lbWf9 |So&[X$)u(!Wʡ$[i݄laZ_=4/#/[xͱm4g+T1(oԦSFՃI[a AMЖ*%m;L}Ix{%*CDR /rX.}>qW֛"Mo[A5Z [uOe^J-*ܹ4l> ʦ(Zqi#9b.*EVAWT,qI |N%qB)=׳cЄ, Dؤ5Odq0!=R$À%&Pr+O554dVd̕@)RiI 38g]BL3\GǍEW@q\elf0AX  %82Ȍ8S~ K7qe|:pNur.i&{oj\"KMjC$ AFIKnjOȏWP,yW@}=ڴGy*f{"e s>Q)*rBoPmLE6+Ft{2̹XKXc·{gJ͕ܙl":Z6TAΠ NmZ8ǩd@8D*e8"3hQ͗XT B>"18Ne~tyfG1 *G ojE!|ƈơhBlH:sAd>!aE"aP؍4Ƣs"ψw9)GeZò3LJ4ԟ 6 1 4@xYSpAM 9 D2|"rH# ؃sx5Go#RL8 0ڞu|9)+iANj&4w5]۳)V 1 {fZ\*{ 'M+{ PubH>:u }NS)q>RW++L{iېrԻ%$mIVyLGZ=P4<ơ%::buPP*iMz)I/PP"i@"PyP ZPyڈ;5q&*p@?@Lj{@ -UHZ$BqAg 6 xP7Bos;\$^zϭiWCP _h`H CZݪ9QE8{|ѴJPJTSs66OV)qܺ3Ck)ps7PR/֡֐>9e\kPl%"T H?#g,8,[n QQ"$ȿSYd%hAP&j1ln36YImQ5[,jq:ٔ+zw-ńÖRo6 QpO®BMlEWGp=)O\\ @XFd<̀#r2s= NdWSS~! 28&M ՁJҹ٥AnՄ,Gv:e Ӣ2Ȁo qN2eV%HG*9i3 K^F8ք^T^nIİHqR"=3ƳMc=,G>+-{RYR'[w */ T}([ĩh)E!Acҵn߹[a-0QJAI=>OZϝ$!mÈNJYfruQ5KrxQU{,w9AOdKnV{K9^@UD!{< :/Y`*Aa}^-M)P?C{Ѥ*u $1nvoŁ;v^Ty*-߫'Tsvω)3`:P?_'1㧗Ysuud=Ѷ*:O*dpvuV!p$(9D&Vy+7h.VٛÊ!@(%@)b/8p4Y/z{UYx%"VI @G6) ~ch75M77DqM{4o&'i+ zzՏ.Pg [TvxՕ.0c*Ԏ:֝} V%{ʼn'.=ML TvIKcx!=F%$} ;D|W*q&t0 s +{FJЩ I߇<aMIp&x +l񳠭%H&Z9koqXǴ:y  *h`- ٟ$B ^oe uW#W*d;tRm볲]B347<4ӏ%!vjV\rdp[#`~ZH Z +}Ek;|kW7>sC=s 9B\t?~D -m O ޤ<au{Y&}j_=s# Х+0?O؝#5 [%(YY-I;'xV&CāBx܊v}/i+rHNPT|je(1"ىMhаB&ڊ"&`>"E+$2-x{ͩ L}U4YvH'X7٠A)9N}x!JنƇ*6A>""j鵰鑱;ӆ veTʫd6!{ej8S5Mo&$൴0:S5t&TrhnG@3"TJī rr.T[T@*; r;]+^7У'{e*l;8}$23ko]Oz%. fL!F*Q$47 b{ѕj-ʥކN$ &&tCVaiէskwÇͲμI9U,7"lxt|!,D%&[0m*3IEi]\ r-oĵ?멵Q"F[b#l1[Qa?ޭuiΛ˺Ohk|ׇ 'sB/B7 ڡ;:ZbX >T1uF@KZBC$|iuN:tP@uH1DUPBL@'7T (")P$EjVL?|*w0V@(P;a,,g8v(qJ˧:;Ƚ@ Z2  R ?RZI*fZECTAEY9|" tE>5[˸f4J9(̢XػYs}9P3& ChEkÝ}m.U`7M I8rScD \x$I'ʡ xa S1٨?e*:ۑ$-/4.F9hrҔuZӅS5`k9m\c2R{"xq'kӪtNnh+NyA28#JR i> ]l7{Fl2@$pE5*4Zk wRV 3m5x+ݟB{}!Ɣ͘%)RFa#ίY:+p\C- %G&:i>dV-M5E%u$ɚG+-fxȝ-%F<|i?l`L[=ҢDt ;KERsM#TŹ\kKgp󬔧QU^MZl])Wʕd\VL~3J HWt±˓$B2A mR(!a h9Mu$;!Y'4H[7G]8n;S(v^MAROFEkܐZUR!&Jy0G{:}6e1K@mF* ōgjQm _VVAdHh׭nc%e-]9ZR6@QA;0^!܅%l>.M O̘bdI,یp䅱RT蹷ї}:oմ~0"-}9ȋ4NH<6527%75_j1~8aSGT<`n.՘h} Թ'OI+DͣBH&Ocx46o3i$e%GT)|TA4nC_M% ) _3]c^m,f𦜪,[?`3lI ȃDr4⌓YJ "5OR wwQh:Lk&] P+x2`f-b%mJf#L2odS8JkE!6W$f]zYOB S4pІ Q\M|[1MH6tі+Vd8ݚ3b;$]}[YӶ&Nn{ RO.r77khcfAmu'YSR`I5لF.:Y yO 'SK$-2#Fs\odkPCSupA @ <5\s8pnlW&D0g+ ZBĞ0@>cV\+u,N6er ְH&ʴE m 6 o&Qp5fCgg: j XYJRoiҍ u6 i/:Ip\[tj)XLҔMEóqj5DD\b ʝO:P]d(3iL_*OZ?SvMᤘ̒LJ$p7ʌ7r2_{ MCbk9aG:Q, 1=?L@C{C*G!EhU3?e:ʠ@V=-UH1z5p% ;4sjwZ-ZFR&NP?ƀo`H$QZ/FN ܍/]ۏ-]Kh;nf;@lnO5N_+n"p+Nc^.)OI*u.\ Xr|̀ LN^`Ad1P"pb"D7wA m@ 2tjqkj 8DΣơ-:DkPT *m.H 8T"mA&yJAIDc s4Ǖ0ddjuԈ/Phӑ֠D)4sB?(NH`S PdhGB=D+*AcvkXѕԅ 9)F{WoQPJe0V?xk{HtKN2%BeVO#Y©ɂCF}T3wdx 4@"()PF2h X SL#)<5c[R G"+1?@, IasZAH^UoHpp_i"E^lCYĥ@s1[̷hsfvamDਿI f\}" <` .k/<xW.1A8(HMq5+tZ}da|Q \¦)"zD[.l(媴 7?bpIڮ+ Yi}\Lvˊ6uXlOu 2eJ'Ғq0ݢ$#y_id'i1[t4U )ZVu#:AmBVEp1YYw頨%RuF'zf}? Xnn5OrJA* sEVEçhVA) 72P.HJ@u^zPxMOufʌ*%j>t;a.B0DH*hz[gX- E p M nS*9ȏO$'ߕ]5AhleJ[k'G68Uv<q peaGU1 a%> n?$Roܐ(a%?\i$-,G{z1 |+yJyP%)O):)U}X¶[;BIjRz;v"+Q4{-XVy丠 BAPXrG gܮI"{P2|dGJU,@glerGT){2* p$%B4XezdkD!CI=<3KLe0JyS;jl&SĨ0`Mt#%7i3N( ;Vf{D^㲣lH*]>bvg r&VlZ@ڌ@Gj Vb$UJ>"l]Jkd]rIY I\ɐ/U}+6K,'p"[H7zSG]j2lQ -F=&RZu+u4 LXۗ/ 4 j<&^B˃sSMٮv.(V giv%ò>ȁ?Ʊ]0" åGD]/fjkal垿JŒA@@5WeOBsoW&ZƔd@d {C—&|x|+wfgȶ )]$f4Le]XL48&% _x+2tYBx8Pa2)“+TQorq̸i1K|y:1{]!6N\rAYeCxaR ˊ.~5Q#i qu6µvuC2H)U~[z8\]6xy+d\M9QIp qJd&nP C!=GkLW}Gdʓ@Zь\>m3=#TC(pWqϑ%ÄHoÕR-- 1"4҅ߖA[o߁`RB-}EQsʔ&ܗZ1lOʩͼGhgzt)ԁ\>cd1*i~{f+V׋i\kDUP$Qc&Ƣ p{D_\60؝RV W)Tp=El{S 6N3#"ijeQU],…ga7Qٹa=(wcldpo%pAnGj kR*`)3Jfzzd&:xiJ^s[7j7P7PHnc!RqcYS(VN<(iKtCBpAVFi;,g0 NhD40GwO6fCxQ-R"׈A`{Iݰxt*uO$t!: 6.Fk" $ZΪ?!X77e:K6&$~(-ZDTn:UT?q4̐EL OoP5܋ݑa #fw.6-4UiF9xT:DB3 J"$3VZ d4 ,(%%PcD Q!ț1@ (m,I(SJ^^:ҡO]h̻'Jt7m5("2 m@Qg1mL␯(@,9˔rsi݋!BC!k!2܎fơISi9̙e1iB/lgŠ rIH)<**c]<(ilj 'Q+gf^"c;Z{2H3y3NŅa[V q3@!"=fvo)7 qe #ZܑbRL^sHj1R5 %並&dEY7V~W۫,n>5AǨc):q@ba.c(G@kR:+z2i9&&TJaDۉ(ܒȁ:J$~Flxt@OH(TGɣB؜]ěkiY6Rװi%vg؃bHL%J4:M?gR깛DJ sBXGJ@th=KPu?m^DЃli[MbhDmxLoY2{U &j1ݹfzHXs65VY`*1PkCD'(Jx$巏.|IV g9뮐xQ'-t>YPRl5FO3Nj GPLFdk4ՙA%QiyFxre(bQ?)Bn_;kp  ~2 o-H%Ea?2Z#*8#+.g/t6ܽ8CG:1˚+=FyNp$Ѝ@:'zS`{rOD}q&toBٚ~HsXW`y\oњ_?Bݴ@ZA8R΀?vm.7)xR kL^׳_jl_"*xOKE:xfF&~jdU( =,m÷TW_3Gfvmݴ%n'O)r"d-%yhThM; JHʱ\pb{E "{p8NM*mmʥ?N$ PaDrG2nڥ8.v %% EL9ֈ۫啽l;.\Q!$_&EЛUetHndUƪQ[NT6p0qnC^%,!3 :S(`$mUbo yBrx肗ԝa63(Va &xsݎޝ Sl-.RA.m <&B{,춂E$Bg+DcEmxw(6XBQ9[ Br u㩚km N)-VeT2 UGi!V9) /q!]T$ƶrT^-ckG֩ Hԏ`G+<8{$5T 8:fOT4xoV/f%pOy$*HF\l6ݏib Uj$yVû4)jE>lS*R(pIyܒў** F)@/0o:џxfWl8/:h rtxnG+*ʍ}YO-5 KՙD.> beqJJJUʈ2e!UBҶwln}?1[{;ފ2.duZsIgZ[GTϽc12Ofùb$3 $mKlM+7>5G# wO,3Mǜ+&`92)Q9|o:bb&F"*KtDZUTJMҫx~t mùn{5YWȲşX*0IprG/tOs;G|ěx_d,=Htt"Li7" Rxs5&ig^\ }"LI-zeF,qe']pG,iFXVAs)\QN<dGθTc4sjPk4ypeXH {@h)N?ӃVN>{i$V2$Kt3+8knֺrj .8\E? $F:*` IQ -n}JRyVeVc[ $ A>QP&H`GskEÃ6Xan6r<* Sora&k[;>m/q$&-jo"FM(nC+N)oqjEl?߅`L˼/\dk:sxsirB.5+uk\|W8x)3B m3f3DԨ _B[hJ:C:B֑1*lǽz< L͇AI}jɎBr׷ A[$) CϐضGRt2)5KL)бxCX?!'  |BxAJEn@:PN4NN( yTleAJ2 ɞtHdy~4V7*VYSrW+T3VtRBs,cw9THe'M;ħVQǤ-): d\]2$huҌUo$PrqjsӷA%#Ԏb G&=;#+,d)B Lk -͙m`TP2'1'5n hJ.BT`"NU\'m}I۵-LL*L S#gh<+T39Aa/ʛM 0U= G+r+k>qq&?|jpBJ]vb( }Q>zdɯhId!*pMdL`n]$,}WGgslwʉ)=h:J:D xy^7|RJA*QVKE;:׻J"Gt@$G$y Ii8@dlGƈT0VJw*: w"'ց:KbFD턊8r~UHֈ^P 2"4669d#"˭X\t8PQ4cfʬlЋ6SV!aKi*#,T /80 G4QoaR ͏t_]zW[ EėT!yTzSc?KdT`:XrM[%8e?`?gM1o}A}*N!EY>YԿٕ;Ow`Lzٖ=5(JYB$h&@T҉RrA>R_-K[mAy@Qe|>r2ffiʾ][Ő3 @98qȫ;hT6)z !&JCT) F',= n)7c[LՇRl[)L(HCLb9Ĉ0FmNp*.h$FSƣ!-+4͹P % 9zΑKAlyLB]PB{fV~ yUTZvmsR{Ҥ.RپQ$_R헻s7wDfP)}QwBR@' )4'B5_ C\ (vʎbm,.FTw^ И@7Qu*[7["6l:TT {@Pz;obnOh;\ViBʼ~Y_b]HJ*u# n@$Z25jJAf 6ZúurVQ#Zt]хf Pt3&Jr †5o$Ip3+p?m$@'HiJȖņ6 *!i $lR>. *N-0儫*B\Ԙ*G_`CIC6bH($ xI l'A#Z/ԩxw\.|CZRdMj#eMssN)!6VU')֦o/f(Gib[5'GHTx1\v(عe~樾ʳ Tn7Xpa֫1YII/QؕZ֚xzRwn/_ӱ$6:f${=ƌ>$}Y[j@"=kjD y!(H@~&ؖYNFsKGvkŲęzN=XQ"s0uDzS;_ˏu hvBr)=+Όx!aq=%!Ɋ2U$]M[DH:JVmL3hב{º]d3:.Z'J m\WǼQ\`s\H^ M> [ɳz<'+\It33p0 9ˊliV3G785F`3i܄jRUA֔%f0äUvȲ^o*|&itmֹ}̍Xݠ=c/Ŷ]NCaIpdB# /?lf5%Y&-sPw%E g&NJo뛝;D|kDׅk _pѽ:Z5(`P99[>3[4iFW{A"Lߐ}Ll1nJdɭD-?qPF9<;S%VqF䄛ws0_D#Y+'AOW/qFe#yBկLƺpwfjM@  yV>]˒z\iIZ&`%6nKIHSxqJB^Y*܈>1oIF|ȂGWR\} i!F5~<+tFsżQ 5їf3,#"_gh~2 ltdq2DU/C"#LEꇳ'eAe4@tQJZN1£ą #MVm*^$w(En͚~R >9GP>Ql똘c r"m ĸKĩè1I9l+nU-ez- t\\@ ϰڸR3D^œZW8쀒kIX sxFIJUte7H'۽/8D0)mgX,8$(gw`aj!ӶY <61䔞"J)n.!PK03TyڶCsi. sePZ$K#hhGznf!j BI<+ Ro wϼ<(IXcUuTF ߅t7S&Q[ *9#dvnso*ԛ 9,jZZŒBf5 }k٣B!Mg$%F`ՐЮ/dXQ Rt"Ze1zY C(>UO-6o:dTJUe(J:Z[ұAY=¦ς[QΩ Z: x٦-H{aQ$S 퇱p>f+&g&ųq9CO?£؊M{ABJ`Q L4IHάXxB˹$~5dV`oS 0{c3OʳK3X6edQPT2WH_g s} t.ϥQ[XaC&IPI0{Pjшߪ.|mF`u Y`ni$Zo[\aɅ¹L^RFVS,8U)YJT&*ͧvd9iS%x4ۇB9qZ#*|KTxVrŌAAtjjNGZҰ$+]kC{ʗ2+4ɀ"yq5~墑Kk FQ"e(/TWw*:Un)|FiN¬J<4NY"N)OjK?ǥhAtt=m\溳B bv} J*Õ5n].% /;yZG'ɫ%_8,–Q $gR` &s>G xlA)"xڵ4ة _yAPʖ雨}$սooU*̶-()Qp:% 1 Q$Z`3Z!V%R9 P˭UF8ʓj bfA/S$*F6Nlj5K;%[1ے \OqˈsߧQLo_n.Pk4AA6ȊEMj bay I0+FUECM!uc~D#v=QL%L:Xp8gؖmEw "y5S􎴵l&k! T$q]\L(r4慫k:8?$}ؠp._~uQ8( -u82rk;?i5I>qe)3r"t;UxlO`z :Aֱ@tZQ[(^`$^iX '0msa3AN!b8"/?:`^}X5i$(M:EhjZtÕNLc~=5yJJub?tq;I@L5l(U=cz(_r>y^OCDb_4OwTH;}]SŦ>Ƽ5Yz"YHm9Ebn/3oh0%Jm)Wyu;&̇xbPM[Uq欵汵pGMzL AEGRc1 ]XIZ'Qyçz݈4Bz4,. @ #-BN4ȁ: TExxQg:J(ˍB-׍ SrzPtDH@ BB+JqA`O@*" Rdlj-U;G,PTEhYd+qvqi<'*jZEkTP#ď:>~7gBd$XB|5I;M ^lWh3t*GDe&mC^K$^f'U>Λ~k IxDyU7x68I:}IkR_f1p!Db b~D&Y+ot5an4ʵS؟'obNT4ۚ7&xRtht?1aJs)R[$nb>̞1η]n9$)',A9&7ct/dv\Gq +T <,(*{ 6Wh:e~uE 5C*K-.!9i\Ž^ >%%sIfW/bKp0iGX VG;\+ƙÏ؃q3@)=nF*ţ'Xl]gpfzΒxZtPjVjXGQ!$uҘSD5A'8 6dyG0Nz-a* q66& 9x2BJ6κL ktDZdM돛͘}:P L_+g^6^@_$j`c:|{vsm₊))GLHy  Hk\6!ĽѡQH@%~XʜFXbC) ٸfLXu9mΖ׳g(7gsfl^ bFHNT߆ëztD _oV/{y=WYG+0.¨%{zI6u RPHl"MQ\YVw P\ȊM݇$x|y.KccZ1xSnIi],eޭqJ[`PDžwe:m+*FOI/(7pym*JIzV.ѺR-oĀ }E|Az~ܸy VmQt\Ƴ{{ʇ6z/Jl~xvMiBKmmQKȸ00xTJ:]2h;3\n꬯o4~=^8C< VJeFt}gj @04#Z K F9+o9B Vm.25ħN`HVxȏK AƆpljC&a[߱LR-bn:1 Z=VQA9k1[XD-#(>GF pC+S7F ۗ".:Dg^`H%J1sR?$(v#F寉EtE~TO)N8e[#й *Q<ņvNU/P̩MR&J2 =`pN/8]I%>$Aa5$AN={ڔZ*h(w'*_2=8"бwqƬ6!ш=Vpr6l8#)J@0zWD *6-eԆl D@"mo/CK!6GhV}xXq} xg eΓ_[ڪ8-Bd9Pbo:>(Wio\Hۍ\T-v'=9L^6]y$:[6Q#8 Wݐ:=(biIq`%MbїQ0BzVܵ1(ZQ\-܍>!_QuWv~{N"Ec/$ \OOM8{uyp5C>ʶNS.=AfvϑVCpfbվj8*'T'^>Hٍ'^5|2lJ]/"G@JGkA1ݤGhuƻpa|)[{Д\-NcXM08&`2]YV%Ԩ|"+ʌ3^/ioR٬$knLQ!b ۯ#P=9 ٹ?Ǖ+:Wvti>T>NW+yo`'0JYX [0.gڋ V8mk443}TbTDh}&ka uOOc Ae `k3ti;*{}F^D J`& [ι {mgn$DP5Xz)&KpAs#U  PcWط)PV&A\@Vk#]..Q*ZȃqlPЗ H>ISh.,{n?wA'8hÀR"/SoYZE&x98Zs'LŽ.%FqDJm=Eu%2ǓRBɈIktHBd^9CrmgJ`X+MiGM8gDV9āơPd$LX:FȖ-*TIt jM)U'w8~5#̞'a_`ni)-\Zox:u? h;Uuo'Kkfd6t\q;rihQӥs (G;HL\G[GZpCt pAʓG L N!ŨK#Jr BP6 $8f@BA<(k~P oP2}(Kj*TIEӚ" @lm^jrC5IDӝ WxTD7Jr5A"HޢQIӄO*$# D"A&>6+spvN$V+pL$.+>XZ#RuE. 7}VI2Tr#YMm.y)َfgBc%\KEKa@P:k#Y.wrc6RWu#M)wRQQRl탈]!KyVO/yFc;S +Sg(R Y h8|7*Mu0aR I+*5Tl[ڪJB Q { y I.!F ,`Ifőm8^6eӗB4#ZRN=4H2|Ƶ)J*=6{iٍItrP[)I߷2)nu^ 9,PWH&1XJO3K,Z΢!BPE1 w[D qND ~ z1hkdJxBGk=(Ó;wXaUwқ-7Zm%#Ck^Ek[84-df2'*С&7+͐%cUKx6AQI* E&Ը-P콵:SdI̤usoGeSJpLyDQoQ)uc8,i zNI)Rǟ W--Ip5ZoMaʆVTfg5Xړr*iQ+axgJxOU qem4>lf,>:Urj'\ 'V)JA:a Saů%'l89$Ou@ͨp|5ͺ+Q0v9ړ*6#Jym\>HFs)*mb5xzޝ]e`N|:lrG娫S=m&Jq BCqtV'{;[h5)l&9KVFצ譺v5DC5{N^>i3Oj hݼ.^ g)f>B|*'^ʄyka,e.73aӯ5H~ 2ty! $ I9RfVu7ʴ={`?k#.ABеY!ĉR%y ikU{5emUPuZBq~/WxԘw[w9q8Rx@ G&M]8[6yQ*Rx1- N=8TIH>>΋ʣ_P_%v@m6DqTA">PvGj \7[G64C JCO $Ӑ֕쇴63%4^D9Sc^c$AY }88p 9t8@,)@1ZeQ*N0VkEeͺkrlh@`'H6*Ϻh|t%$G*f.3EòvOz[>\l!*$ ?i\8T xa SւO[oYp݁ N% ̅'5nGq_Se%\xbӡQB[n5,1egrr  k\৩F:`Df'TOۋ [ظ/0 MƸͱT:^jyu@e;@:/3a#»|>G7,N)x(T>ML9 ƸĨ4H!փ<-X&W;F]i`M> iB5f 4}YoJ@2鈶W/rjR4k!p.5@;gv=nOў>f9V#A$L 4P ؕtu1d{7Q_[M)i"f |wО̑`(GuI)?q3*Ǻ,& T5O)H$FDވ*YAcJۃQD)9 zOr 8~Ogx)x",Sof8VHTA\-£!l 2"΀#lK G~5S, "8}OgʟI5F^ f0 uoA.ئH +75Fo+-;7ØWcH<뙃4V;#( >5f$i^C.?gipι xT YB BY$|»H:|;ڞqsPVn(h2I$*$:h6Ŧ8\m*I 5BB;AO!~1bEDH@BuҀO(}t@ysA)X=BÃA}o5F(1zҠB1YmYoa tA։)a $#0 !kz83@CD y gʡ -`IםZջRpP{I"GU0N2a"c/}̴HkzT;;;<[m;gU'h|o[G'"":k{U[nmwj4l,lCq&W$E(OV y5 ړNp00܀ܘZ֭@׵ ׆RPכ3V8//{9K% *ƪʟA$X׍]BLkDP3H)@ey~XT&@a?f$O""̥A Kt٭(H"3fQRtp{=IOi(*Hߍ\ Bؕ`($-?hXZR[Z 5$Mԛ+:/J> }$8ʂMzvVF:V7:OQz ;=\eFGvY,b@&UԃǘMZ+SkfKJs%`F{UCJ*QU@c\qjmyA)A 9gJAΔa xQ #nţXfUE!_bJT\; 85Y/ pP9FRgJ2cT*/`[f67x<'(ǻuC1BJHr YL *F 1 p/ | 1VE_1'fCj}*BU^R*7 Reru̦ԑ';-.)Y)'hY-y& h u7=$J46Żݖy:I5Rrv˒m֫ĩH9iEѴ 00V Y  :jII?B"qq0gRT%Nc2 yV;&ȪJC!T{Er-p8(׿]e )(%Z%D&p7# e"3\tirFoYKx+(ik(i{ $LaCMV,3Ml'aRJfȪL/b\A Wc:%D$j$pMdݖqxwVJxhBM8+Z2nGSQ -%V"|EZxщU/LCIǝmU~Ng"L4PH>"j+w(X -e,38 EVҲӠdT7X "~4ZDB,R5i{ 9)*Rg' = ыc٫ -+Ю,usg*͖tMUjٗ^1$_Ğ^f2Xfmj?Dx1񥠊g ĎY<\x GLj8,O]y"2 h4}I}jġlbjQ,~/53^Al>K"6e6A'Ƹf!W6<*{gv)TI,٩~u7 (=? k:֘U͊xɜF {r8 wCWm+mdm{?JBxFiePI I6>t$ :FN "v`G~1WW/?lJUӡ`1A)iw򮌕FXpqo&_J2\kb>51ϒ.6)= 6_#$|ƨ"b $ofpMC*Fl@u(f+N `S^r3 `O"ߝe«z1?AøuNAiµHn쳂ày]|"gOX*EHg#m,[R{"uƞKLG1we& us 7)){H5q> NfvPQo[o|4n+~[u( ̤=˕ Og53E tguɩ\IU\.NW_S _xD+?HQ"֒4)BZ(+24QHN2հu&g6YL4 Gd) cf؄x\B]jSx8NSo»<<<:f*L 󮩎6Djtrb Ы@k>o+- 7eG'^va~3v4, f`4t#:g1"ڠMhLH Ν)B6۹{TCAFMJ:P$G*APxH֙ A1 G4@d@G{!OKmd$JC"6S1ǝQ δH AP-H6dC*'j8B Dr <yvuNň@ 3hӍEio#]g +BONOκ1Ġ?bbn{2;xtSYre싣 Nw4]G~&\ Ɣwx Ȟy+SlgX̖C[)E ,gl4  )t3KYdHS(E6lV@xA1nmˤsr[D.`s%A>{Ũ!*Q)b:k3—,]o6wh!H*FP2{o[qAEZ(#l͊$0I6OA&ҚYyJe+`avICf0>?3b˄PH$,E}إE0s}3QI`UoKwNk٫ mE$A<ylऩF9np)W/.tiڛ@'<+<$,Ev'v3L r@WÑ+v{ۇc ߺcN`:]3BvJTh )CDM@ @a8Dh%ڧ #Š @U ܥZ(AĞHt4@De khP09RRl(\΁"*eJ]N=BH @MC֔b3x,9Lp%D*uO4BPP9BˆRuB5C@ Hhl|jDa-7G$ݙnQ.)'džts/C[WH4HEq7.o36C{Hj1]3eV<&[& %%P$ Ug~̇{@ K"Q DAoF?PÀN#Jv1 HlOb4 mOO٠2*6 ͚ I)lPf1M'A7BxH;  Je&mW!ia*w,̨MOZipDnPtW/,hSk2fX 3s1Um| ;{a'rr=UXr8 {8Jz]Jw%ٛ:UsգD`= Ť(*\ ݇#E~ҦPUn&'knPiZT,}AԷAW&թ-F Lʌ_vI6EQ{0$dDͫNR%netN­"jmzh[Ne}u>uF^7K) k/"EDy. jrh`L[dG0~u33N> <ʳ ER02 oZɵ0̷o(3(\ t ,va0"6]Rn9g&S9| rU8DZZX~> -ڨ(sZRzq3j!AY$ t˧Kg3- N^ɓEdp<ܗۗwH[/9y=6GqVCYd%P`D ho=H\0x9}eeC'),αV8j+*tmZ1*$:xOzV,v%8 jd.: UTEi|ݔÉNiGjPP 7*T)U*{ɋ̢dN?bމ81ag6 RkTS$]:"D|N*L\fEC>:!QJxjHt *0[YpU`H"@2"{qk{ۡv 1?X3H9qVHԯYZZ|Gzں\3p-axC ,͊u3VJJwFĆ! WyiZkp0z&4D`~%P+x)l2L9H5:z:q 3)ÀHR1{4M{_W&!ĥbՏ:IRgNZpW$px.aRAKe 6?+M2hJׯbqe *Q"㼥T|HZq*0 ; Γq3"5٬߉} t>V>0Mi)ǩ5^W01 r D"qn}I?S91.$z jyKcfu;~}JmhUVk*o pȐ/Zr#)xT5Qy}'CNl &|*aH:4[-߽Zf)j)Txt5"G=aʜmF,ͫU\.!J@qШ2vt1cET56|$W+,th#DD VoPXP/uvC,t{7S.P$2l/fi63 0+UIM {Hc;`*?j5U ȋuf[NS߀[2rPg' ogV)>u£xܷQ:-&+~wF|k6$s& UFKk(u&L#ӧpX/1#rm3M\RCWZxڸJI#J< d@Nt'RJP#/*1KGgd>42IMeJWg}5ĥ@xž5l4ŒcY`ƻM#v{ 0\\Ͱ{ =9r[}qPQ Mt;:߱# m c䴒g]fD j0o4Zz7qFboY}* 4Y9DZI^ahYi7Ѱxm[u3/yZ1-\\2b#PgͶG}q#_] 럩b00|޸wGF7!TpCc3 @3 Jь|V9@v'(2Jo,!1~1:Fؖ9?DFeH:X2/65߲TT4+[:} 5tɵ]DqC0ca.␜R'} 7ߵU?Aog} 9x2ƁyZ"T`l{7õ2 MX Jb)Z޵E)f4֔am3޶#JaG\P4xAfa&HP P;6B%IF8CPAAtsG1PޠHxtHO<׍B -g'TBio`uPA{S<XX6FBGi$:\QP^pQ T(|j6"z 0ݫwxVJRwcI1X֧[n;4Je1fJfҖ;&$)ၾx#g{EbVV 3ҺI(37e٘le;S$_W&U^/GHv-u(]lƻ R _QK[c 9T.2DfAHJzJv;{C\@JE1uк GlhUXsCΪ"g˭Bmy.ҘDM i*<$D^zݛ*u=Y,+IW(ө&_37CDOגA +\p[;ɷw@zA?)] JReɘf \rÝl2۩v*5ReG3Ii.Pf *wsUZAU!͜!"E;Wpcsw|Zb@|jfwCxRʳ)@6V\>bܜۯAztQ^s#,-*YQrr:U"'ʺKec,*9i2zQi5쭔j$92*5,5p8Vbɫf Ʒ/iI-& 6+&^KaOic0A["%-nNfr!}3TއZ} iίUL{hnOvQ66 9.Cg3d)WiOR^Iu1cVd=::\cV> 61z,pfc ےMDA0LYwf ^UbiG@f}æ uq 0O/{ 1 @Wzo߻U_l6Fd4ȅe9Fx5;,U̦~)'])fd&ӋuH$:2ID\kc$H -jd=xּ{H^7m+)Hb`@=GUDvTD} 1س H̐E(w֛.M^/ }+fNRG2xljKJnǕdf:4ꁛL*_I?:8ȯ/96'+7Vd!a+Li2=W7r-WbE+NcxY/+i 2 Js$wF-[kbau eI R6 9%_(v" Ʌ z+Bji;+ rwjt|}c}Z89Gs{DCV4`Qc~CSXMeD=Rd73LOCOS{)>:\"}}Dҙ ̯r hʯңJ,C `Rr֩@#W+o2!KuKZhxГVjޯ萕?e҆!A P:tR{6R:3TMin4 dR~To1f> 0nQ|,Oh~p冞 I-i%}mO I?~OHJ ÜFI!1(" 9@66^WBʙS=:~>{(ǣ @ZILHt i;HSe9 R-C@9d󭸰lr3ĶT/&fu(~g@NutNIy΃#<*Oq ?^tX]R 9q:4"@P]3}ډŻRSci&UW_J1v_tO1Z}ab;f_&N_p*:c|q*P<* !&`,eQ}< Ԍ3PlŸkm:I;MNV~ot#8d@'(9rAbd 45J96һg{ed8R .'yxg9SMi!B+j*wj iE7Y$jp7;v'p}jxչpkvf Y)Tgk51]8ǔ'^ B5-۳ 0!g΄vl픮Aª7 Jrd?~z_ G85,G$YTԻ{;g²Qm.큍!s5P 1YBo+bg8b=?F1o;r &XW7C}tg1 p¸aTn[$ U%:_JY\ ӇL!Rd4p9ޛP'vX/+>;KŨYfzΐO O-a(#,c| 6&XXfka[ SΪ!h0Onc}x:F_aўRNM:x--uTIng ͧJF& y"M`^s҉'cҳg{CL_]:W;:Uūcikn+[}Ӛm˥HY:vbz;@AssZ8(MʡNm;@@n k@!ǝB4y #6ҡF@xJ8Ut(%2x!ŀ|J@w^QX]@JRT &'-+n\@_z\(N8 ha.OtPut&E}$'5*uB&_.ǙHґ2Ro>ܭ'9[kmZ1w+HJsDOYWr g`q2BHY:W;6K,6hhI\I9o_Z7E%e٢WDP;l=V ]Hr:Y%.!ciBu3=*Pg:bZ&)B'ɩҠD~@¸ ֘҄ZqҘ?I*Q=(T@$u ^GZccƈٞ? #HO ՋRbS+ ֚KY/ʡ !rDrq+P 3X(p7k "h30zfHtc\ݧp̍~~3\Lfo%wJKɗXQ9t2>T#%‘)#g=+++@:h+_V2GǭbfHH)icWnؒDRA'd$taJ w?$^ǔciaJzxJsشC1s1T[E> HM_LO]!$ $y:)>Xv\HQOjٗԭl kfo%Òi`~ӍOxSȾjFi@5jQy%D=^0rw,Lю:v)U)͠,(XhjAЬ i%4.LoPev픛k&J{$I ?{VBʐ=8pQ+Vi~1ļ0R{I$F/nvqah/}H g$ʺ 5oGu3f;+"`($OK,ub/{xa{J'PmbTZ=sl 0~u\iuAnЬ*0`)HH}֞GmǍy] 퉳pB򊉽\iWdqH˝7!&J[FD:yީxbV{7v!nbD21R"Z)^xD+ t"%&%kpPBUPgzQi?+ G)RRۘ'Si=G4MXtZ:#Q8V˺t/qԬ]{P9&N>x~[Od?Bjf3Yid\F/6dT o :p}Q9@"v5\ss'ɀ}>5N/_fCgyU,X1I0Q'WF30B;7e%Ɩ!q` Nۏ;>rAnvoP#ú^_VZf~+30'=t) ià-R-)$x {~zl'ge!iTl:ԕz~e.OfPG5|c[V5}?x~1O>͒?vPF{|1)79ԸNt:$uEHRG>Uv_/XrcK=#V\ۨbl+f#)W>7rZ ľH40>4 z{A2 mRq{2;ax \@`3< gqԝmL:䙲vv%2 U tjŖFV7or T.;֛qgn!xIM2GSBNXrɒg; t멧Ԯp~n+U߈ŻxX |(DT C+-8S JҘB:q@[ڍnjӧJpb8I% B&R}.>5vԧR6>DZWR$M'Qfsi 0/~n9I^p@3VĢmeΦ%m~T?ݲww{Ftd&Tbʅ^ 寅f+䵔Bp^WfW&TYaױ ҇!m$j$;GvqPD!|2= t%mҮJb}Q*~%aNc6zCk-@fr5rb.@I~uEt H>SP" Zbvz1I(q!IP?iVf*Wc G*am)>=$sd5Qq$~5Yu*[".TQhJPV`#:Sb@ t) bdålvR` @δwt'@5Iz've3$&gk.G l*H1b) IbՉqA8c~u)ȭSr;Fh1~X:-RRPy,JBp[[$wKLvJ1ҷ3l-V7 %HSDSQ{]CH@de2;4lJE#j+*sq/KNd\*ڷ%aYf (7ɞxtu^5kfy9)TA~򩋏$!.`) "Y<M/ YgpRbI!Z6drvͬՌ`)k(P#UD:Mo`pY۝yW:FXFw2l'ۥT$Xb@ ټ|ŠITJ: Q Q}R2D}9|AgW6s{7j2e ƺ3Eܦ6R 9{k|ۋťe E,%AZ8ӁP CdADA˭qB:^39Z$uSisT .mʡ jZ Jy y=¡- ցPAӝie= BUMP g/:if<HǷ8 I$fqVZ]Z7cRCHI(&[Z”;Х NSӁq~("vw|lvTh*?$k6\߱l#G> ^+ٞ<+F :ey'[^H׿κF@ 0' O}7*fb gι3Rj l P&uU冄v쇽vl f7"fO YV %ϔvtV.FPH|+_agl&@LB&OV dPnlңeb[@Bv4.[{lYLSҕgݸ#b:YC@)t:(]nP.[ŔdP$I"BSj@IrLFRd;Afp܋X X.ms: ]@A2|l8)/E$Ai'"FQTޗbI` ^7 v^N@xIO9+f=Uy[g0PZ(w6R#( )bDVӴ{JJPe!œ)\@yGZ>7Cm/`vYN<U69X21bnf# iO;GS'[v.aʓuv' Y<."B݂1mbU6=FҟG]3WpFVUeIub1Aow`  DžXsbѦ&^\'2zxZ4Fo^#QЀ@VSFhZ\%[t [jdW9ejЙ#HBJR"*%DUZi9hV`zUHq@A(4HùiΈ .DFw1Ujx\ZHF)ZthSr5֧Py Zd|Q:Z_@߁݊P%Z& hqr@i!DN4@>O @"-H1J4l$$aƠOh)esQ0PmNos"V5M4f_(pPb {I~&NJxVܮ× $G)Oh^~\\|:8$Ib/ +itN}WfRHE)2d VQ?>a@! I?+Sj/#?bXbLH'D4G>UnVi{<os u_t bm`7XO =||@hyW\ pWu$]-<4XUu _c6;($/4@JVȴZ'x}K`#otmž$gqDOtXf[KDر{avh82;E$b'HR~ WOWEHʄʂF@Ԛ.rV‰y-#gIqF] Q6'7[s| dGW?ӁlKWy&x~C%2pmf}T6jF^y12/֓WO@:ݎLDŽkI|曒UrnSvFacVlrHS[q?ְ 1~טgǗYdEV۪ 3*·F$EՐǥrVZ % e)9+:wɪ.NGM~F tZ4:^o- b\f/Z Zt;sHQƠ,@1Z0 L΃ACJ̥ƀR S!ֵ`u"SO2k̈X֔}zN-K fnO¸M=rU\qVFi  -3UG}C!21AJ܉B**ZRoQ mwmDQ*k6IDɛA+g` Ҧ"Oљn^>(mpqąTlUb6p|`к%Y0aȔ2H')Ū[JlyxR 0) jBGQO(ЪVXPD:u(R&&Rg2HE =*BZ?b|P! #HC!ũ)Td"HPo~3BM(ՂƔN"O4vSM'@&D߈: 6^ .sy'쟗uq˼u1Iia_IJTfurmN,2NPE9F$f1uF91+VQēTJ6X|zZq+PgVo\K)Yju#RX[I"gҢ[iۻ--]~L}FV͸ ӕB+l${lR%Q²c4߫ᔕ" B#*̫λ#S'뎧IH\мF|K^=% f#$4D 2w˝B*q : :j9H$4:- A:Ҍ0〘€FVM@$$@"4HMB 5Jmy"/@q#C\P -H^GR4ADΗU0 AiBFK="u@$7K{_+J aXʑU@ RR ɕx]ExԸޝ#6L^_:=oyʌ*d d5% ÏBI LR([ilb򴎼ƅ`ۻ)KKJ,A" zԔJ/NL'ĝM[خ cβ&@R6+*%,q FTg?=z +W[%=xTw+CEB(Mϐg bFAІ;LK?k9X~ɬ^R~q q'%$$)Ɵual!:nK2{A$oiujd(M 0z 9*(7KeFܵJ|.KߛjMMb!N)`DpL"zSq:캂IråqT{Y[;'f beEm!AEdEƃoO6 vEJJE`O6sh,--Iq_ga-+e6PKlʣNxu$2w,Jܗ1*RI@PӼxGB ?a;)%nf. +SR *oc$ uF{]M1W Z^.GJ&"*9t1)*UnBTJ$¹]7bKܿsYKD 4UlFo)ZA?*DA-L{fbIܔ%L) *"9ȤCZ ww\.w4ȏƯRYU>Jay%%Ad(܅uunA[7v %`"’QI6/keV P$Hgy\-Ti[bZ;D%(iU8 vHMTR^siJ@yU8;7HdbfZ\9DFI[ǧ:s Sz0憥dUVҷk_SNhYYt0'{ʉIvEq0-]0qt$@r;Hۻ {L:`P8dULYGУcBLhTmcY*IHj'Ǭ^{VlҴ+vUݧ r2 %|#P\8At;S-xEBgBrEd[c^?F1͖d\B:) R3{+ʑϟ#yߺV§.5! l]{jރ"F[tgQt*{GlIrLX!CƗ 1PoiBYH̰JEy_|\UN 1zzK`WY}<!_RZ8!13ُÅW]J]D!%P~&5W.w+DJ.cھ}Ą)#W?.˨nASXŖ* fRkDrmZco'A/lrR & 5E٢P%ڎa:BDkrTEй1 KISq1'3}pT$RcVDhVBVk$ƯJREg7)b*'DB}x]O,mi@lNci$!9c$6NVY%TW2:e$Rt([D *J(d60IB RH3@sv@rIPm}'( \ca+tJ}KRBT.DV\'A׆JLX/DWQFCN'uG1²ũjEl m..P +̽1jh6ښpI#lGcw3͹~oJ `#RG u#+wu0F**w7 t³Fw7еTF;E9J`ΪOוf͏Kle{ mm27uEyOсƈm@G;*ЩP Fu >#JdDC5rʔbIV%D*>4j[gW<&9q4ҥK11e+7A6tcL@T}^}9kZniE2[’pIKn ŧB vE$sIOuWXsesHUm_GʬD-CَZQ$̤| Q.?bJ`N8#2J`@{0F$@ժ3]lH!C]*t?3)i 1L+i)3.v e pKÿ濕V oFW@U[ Wm!d%D \ymө]KCYq7>42yXcɩw1DA \Rp˃g8h*`coـ8RB5LKP"[8'vت "S a r H;VbC*ԅLDA1]J\0qvZ;ֱvRJ݆J`ĘW?UykZd-֣2u)D0sq⨱t7 BdӍ-p8&KB&/X"߸Q7D1J¨ҡoD6%A]4 3*yE7͇V %@@ <惻M ȝ@S!jL4݂f#(hR^tPA׍ 6qˏ¡[[c'm4[]O.b;Q VuX7{`x+QZRԾ0t醮MJ/KdCi]ϝ1in-={5+g Ė\J2A*3flݩq LW6  Α 1FLTP:CLpZ>~ ЍR?Gz //ؓ"{V:G_+2CJxv2'ןQ\%d\C)pGjsLr?L@'}~~5%ȏ V9PUd<ʕv+gufȄ;=IHJFx:r-q3)е`ߴ'$jB#NeN̹]8q9PBP>όb#'AY3Կ3[vX{7_+Ԃxqһbj ad^]QOGiqpMy+'CPАB : EBsnU6=޵8KB {CN4=$T ںDn B4L^vbF4HIAyLWNQDM2|(✎MQiPxkPzPd+_e*קBd1x6J/,{0A4HJBs QC*W QB7@# |1!K(m AL'*?1̼l7m`Tʐ&:jf}v (R4>pH'l LGX(WrBZ\L)AH̊E6$9`/Ĥ' Q*v%~5͙NTvΫ)9EX^lf%fzMb.!%OfI&UGEӶC(ﬞbl+asadh(\&~5yKc p*tA&$s-9x4&7v1KdK2)zDp|kJSͼm CRHxf A$ҡ* ,>L8|zx\4+KJ!!D(x֔S&> H9FemJVjbl엊SIK8Y2NzF4M.)9O`Vl~:Ivw+r|6[9 2 @C!mVRӁ;JL}j$0Ȋy,2Z]m!i/7x"FDRTrUa7?zT6 0hsK \G@8@AƀO%wwc7h} f ~5(JvCx!K쭬V2=o(sj"XT!ű&jQ29lp*Pl-i#J@o>ِ<4Θxou SoH=j~ y ȥ5nXjl2P5S/ت(F5ԧ0 FSaҵdzZE1V6#5ґÙ­ m!b#q=3k ޤp2&o~Uk)Q+85ey-5 eBùiGRD^GM)TpYkTrt9s$apk : #8f5*v@?16 -ҶiLݱ[8%J:䆒N ( g[r^qFF?:fpKI@T"FIUt9ӕg {#`$:L&3ze.$΃B% q«ۣ)fֻ^skx5XlJ\d(DL[^t\"ecNٽ!E(Q̪+$eum["Btk},ojoؤلǻ$x֊w:bB Ֆ\ f˥x$뭐?ƥ'*>gRt|+T.Rí?ΰK Jpa-N*Ϳ)O;IoÌA-#D ud*@nZ*(pNRp'ZZ{({5;&T۬=k.JM?4Gd3^ZFkdw}JetV8D'ڦgLܨ >w0ަځcgb2+kLb݌h mV6X|Vzj̉gSy'C/#—]J$Zlm@*l@G`=ƄL)Da̰W)Zyc-VFwݧk*@.ӓ&[PdMk'D0jAd|s^hΰVI IQX ʴ{VʫGڮ!/e@`-8/fƹ*v8 BT+ JPi?i2Ep[-bC?5 YguEd-ܡ0W̉سV̮PG¹Y uҥ H y84<$aL y*@`P=(Y@ C@` 1L)66y1sTL@" ’-{C@ob@(x/ƀhJjY(P6Lķ:Pn8M2e4PK;U9`%`U~hQV`{8"2^u|o\e[0bR$hgQXh2ZPo^18,:UJUxk5~(-I[t(iTH~6M*!4&I)/=kk

]'=Ma쉓%/4E։EfHri)h+θD͒:!=KqA1$p@Ks|kV2EY*Pt*R}jAAaI\#b.c%Ԕ c~.&XM9B`iXWZ3xNaBG4HrzTd=PP-PdDK9yP 2X"fJf׵F9#@#@w&΁Rw6q4@4Tmo4uHT+^&qO>4H,'6@#,\mP) T!f@"HɣD<; Lޡ%( J{\P88ǕkoXAٓێ)$fCNꔷMNm )2DzOÍػQSi#5dihҚSM\b[P@ivuƻ VR*OTq?vB'kn:DiO!7$j:V\-:)'2>LpwG# Қa؟SM_sfmK)oؖv{3Ap2I (L%ZԯՆٻXihRsNI }FT&EKR+ $ߝhRةh]cI=)' J-o~('Th#+u#s ?s6iG w0Gb)ZD5T^9V )$ʹI@LIѠ:]udҡe*8:T!! :d* l5A.$,,uuK)|O:Xɕ@2)@n JV[QJso>bO^㱛 ÄO8:8,R)fpF'6mHD#;lT̬NT {e q6<)"-IfboaJ0dV*c,$XŰsipV|0eR+Džk)V!9*Rt:Jiáb'07e:=U ސj BP ߐ_nK. P4$ <י2KVmF$ftY)ǫ~T4ujQBJP'm86+g*F$dAWXӝ[cr-j ptJT4YeP;[% |yV8;芧**w}XB*i\>`k,':e Fc m^+mB%D$̘4q` ;̈́K! /8o],W- :pڐ#.۵ cʥ7#""}O&OJ4˖6qV%b0۵HUIVOv'0P^ o%isB kc1V)j^> !YBLAòt L&I IIlBGFbr$[ZEݧ{LCy>#Yrm,w%|݁?ɮOM^}RNyb #O٬*-Oˆ1pAǟ&7"bʁ}*YPHחC~Z|jFJQ3B u<Ь>r05EY< PfޔlZ$)F#28j& - Bq J¢@P ;ILu* Pj$m ̂dO و'+(r<:"2q׹%t2|;Ƀ5f{m{3ie?ݚ:J6㒾igFRY%DXBfp XBCAoZ)(&/DH P%gCQ5~62߅l2E3wDDMP1Qa[}A+/.x^<1c*/_Ҹ@ ~ƠJF,IJrCS"مiQ0޵ #*Fa:H QGeIDysta$yP*6sfRDh0 3jve˗7#2]YԨ*d*mYܥ87%* yׇh wDao@'Y}/\+Yhdjۄ 6Gh \dְI % `7Π-%wuu$!ԌĤz~T!Т0]Vb51 T /J S,*WfHCFKEB"#D:2wA)[Y'|A@'ZX*" Sr3EC.@T҇8T! ^(,H֠-ґOKJMȂ ysd3BJOΉLP N(2 !)F`plvS8;Nk`BA])Cu3/6сmOa"m:X#NTdK!TIVtDoxu΍uoafY5cIBe'XKD(n\ú5y )gJ t-7'yAMJBtIPJ#}:xjոL~E"ӰNX,_G&e3wWv4Ua 0Hu7-8G/434\zP]nXRRJU&A·|/bP} C`TNQ(1rW2V^͜*m ?VIKTUhM;9t嘈ɏi^HyJi~@\GyG Տ')(5%J0']nIkmDnGqyH#`<({.[#Nw=B yơ*x! ǍB k@"RP?P\{kPTd@_zu('AI5u(ơ"AAnLu4uxyXX&b#s80ZZi䧼8(+y6@)_!D@@n4BAx 41EwA$ D tȩd};[7%x3LIL vVĤUgJ { ADt;<|&\r׻r"%[|*ITE: Y:;^98eeMrG݋^R.hEf;:? #n Hڧϐvk*aJiPVߟup3D l|mJ%SʯқWa8uwA\Jl( npUcG**"l͢F†8V%JV_y;9HҰ/k2( D4X%j¡.-$M#3UJH!ޡ b*7CL5m-_o{ègH)ljLZL~H=pb!I[Dž6dH 2Mx'p$EzkVf/)KF!Jd#AOc䁵?1m3x5t%Pb+a^m1`ŏmLb-'fZ s% 1ʒ$*v?7ax(aM]AKú+hI6h[o#ۂ^bGu'5\M"(ol8E$% 5 sW9n)W.٧[7$5|ޔ"Vôr! )6k/X>]2w)x$TwSԗ}x\"[Cmf|3 1\Gľ 2{1흇8.Ԑ2gEH߉#Σz}¶)qQN:%(Cͥ Q #BRRcIW(^wֆB$.X >ǾFaPvny,w]}•6`؈7IDΕNWQ[H`HHb[kO@KsoAS&+;Zs"@0o}k>}Dݷ qMM6_#$9$ p'g]M>}Փ2Vf H`³Ғ Gxu.&9TTF4a#qJ{Hp aR"íGd,oB :y%$YB r<(D޹@>QaNlÔR}-i:!*J[8pΣ";Jt 4A$toMB3IOE %8t #ҏ I٦O M2`ʥ|~*ed) TOLSD3RDMM/Ж9q $ č'C2beI?:AbJjxE#Cf+P$ԁb G.vAB РC~5!w@poaz)Djn)H+ 1ǝ N"yM8AD$m~4%O7S${:Ґ ~F\oÝ(Ff8_#E‚`'z _ʡ-&שdS dm$JC~: yйIyb:i,$w5|)¡?Vs hj-_J($2I-`EV9:|\G\s*;G$@Ga3{D9|Z&|Ej;MOIƈ ^6xϬypA7EMxO´`Y1qk(:SjOҫ $J_FÂ$x͑[1$0F:9kΓb{j)fpW ͕ٗgI9oTr:ח,ds:ϝFĩi7q&}Jxon u1t5s>_^Fcv.ư pDc |:Q (E)O&B i9E8'5urL*KȊ; :8 " Dyi>,"4TBPTA|L@xPBơg }y*e<(F}h6kމ@U 4A-& 3(Ae9](Oldm%K0)W EjvU=f   +z lW{FR1 甙5gR" P$OVdR_dCQO Q#*Flݛc(6OlETҙe 1 XJV8LO3­uL^C{N٧Y,#j.rjJۊ"7 i:fUdڷhJٟUyJuq'/Q֢+_J^QCDwv^JJ1Rxe&u;&іPډ JeWHLsi8RM~3FHcF8@9H9MEIZ%Aަ7 Tbo!@^tko.ZSkU6I<&Ɲ=6ۑmX D+:~ Utj'L-XL@BEqxe*@'Q$&8@fʂΡ $ o$EhPu&L`ɹ>1ʴ2Τ¢#f ?FP?|-r;G BhD le]€H;Eg U9Dbv[YT?*)"κlLY+}#Ra^1] L|] zU%+)43D Ԏ|jJNsg#:4+"G¤ȥA8 9I:qe1#&Y1ȠM¡3! MV{JU}&MUJ9ixޮ&70vuTtpR^'53#A= e+gwO{]Y/+ 3 *=ۍBWITF -2ȁqֲmnXSlӄGbRWhĩ7񭑭3Ffɘ R܅ۇ-9E,č h6JG֌NTL63l8&O ICwjF %Cc. @dSkQW:u5_PZ)Zx$AbmEÈ/aDsG.p픠 }B*mMSZ;JULN]0lTIt0x(ݯb.0!N5)p8((i{X16ӋJ'm-6֒dթ1D0E-3C5hث$ I:8qʶkm)H6&?*;p(Q[gOҹ_&Sdv΂eR1mN3YKZXB擅ĥM) v= WƳӎ<we}KQNe#R?CSin~gۘ'U D6;sL(q4qNDl4us}jRB #7:Nl4H<4D$ӬqcER5P8e|6ź,Y#[f= p@*SKI[TѝdRČ^{Ir*_쟝u;7<]8LLuO(NX~v@*ދqvM "JwՖ4f. yՒZ)N.췄Ft9\+:6`'ڄ/#Z;SZdGMml&[!xPh{fI-PMuTAܮ'^UҴb^%+anҰSʫɑ%HhQB{G .lis&TcSS3[w%.G7Vi4&]8tE[:Q\l7'+i>NYч-T~ ZUC =JDj8'Y"mD7*Iq"WȪʗl ΝsWCKv+D=K&Tob9P;Ea\uIJПQ)zHӒ/ݑB*v#X)ԉhv!m%#H2`EXu־ \?q)RT]HRRzd񶗧kWv0EÈ6O=8hGx2,W+fĥ7101"nnV)\\}s֯#+)]ObLVӨ*&DJ>urhV b%*>ᔙЪRjƊ"rqam F̘?TM] 腾8$iBLe)՘]If yjJc?? l|u8b6_#$<ƙVUb5ؑs+jUDu*zޛ?$<Z1IZ erPGhXF˹xU-~g!DJb >J`[Ch ss 1Jt~ΔaA3[jh%=JFJq0 šo =p>l я/r}VW]O~n%_"M@uVܻEChKyWpnڈZ׆qT [bi>t fʚ2mp3 Vj?sUuOOΕk5‰Q\gp[ r*9Lb7@״:su[2f3`r^*і)e(]/ pؔޑ 3Ofμ%ݰ{ ᛌ!B+kV;LƻwG=ON+<\̛ͻ:TDKDP,hZX‰dhBU޵%}(\G:bt(iy^AxPPi$ րO6n` AA$3ЊC#Bp3+IeP2Va, -.nm kE}$҈$ 7ӥ qB&:B3'|8Pk AJ'_ 1o T#Sjh`upıň1` ӏ3t0, p8eH&ՇnIM2\@ ]!YOEvdcC)$&c(' tMV^Pl )(kM TIj NugUv'@oюR$UP,^.*cmr:,mE P8r $)Y׮l~eVRL(ŏ2#=\5nA h#)bIqd"ӯx#в;nHWlOfsd~_ؑmqJa'+)6pÕ#m_QŦGi+8 dlVǍS& ai e㗼K7B!Cč}Z=Зs}0)mĬSowJ[ 3ۉVRQhE6VEmz1_|Hw"VX6 W>mPtVd <\F7l`ӟ%* dHƩcW8 N! V@qWc[ēJ.HJosheHe ֠x<8םDGK%B;_>8k > {PvXT͉ΖrѺfxBd_)ΚVmo#ZXI M_4. ~0Ќհ2uSϖжFB 9WRF7'a^Ĺi%ɟp5̒{w+SD5+kriPlxUvTѠlc(+Μ8,娰¦bcyD'`HJMu@'JaJjN!O^( o&@ Ev1/ 9佼Px%DψTǴIp ͌R-1e" B; j8ЂI /'*Jf'4w 3EŴ-g*ɾX\VbOxq~+?KO.w~=7ig2j}t;og}0H%=GJ{uCXյq( JFQӺ eaA* f1n)jvKdA47hl$`LՏdAM{E RDo<8 `hAOhl"IWvsz4Y=v)G KA̩ʛ\Ir F]w֦݂{;wRP|xVYdyv["* N$/6]-*CYOiܪMNU=t)@'Dǩ-m+mA!Na+TOU\}=d8ᕕGSb=4  ||̻F>Ȩ-ĥ CTe$Ǡ36(9  7~ŌnH'A2 >&ioٲ׸I)I)*45:elm-yOl߼3 +be WmOdT(8&3_.S'eJ0KIOAs~*qAlTP `HQ4Y2ʚ4AY|Jʢa:hFQҟYN~h,. rȽ.u7bt8x8MiyEƠ5z e_:9OYNBV{c՝0V8|bEM 񦭁d/y֔c|hK++HFh .PA~FO4dgυ3T)>1rVcyqP42,؞Z5^z|bv"VkP Ӆ-Aa xQSV|D:R=M&ڭ"1BR`ȵKAC2/ߕ%YJRY%`R )*@;kruO-̡@H GZBBݑ> 1[r_cEĴ7[5[- Dơ愉S0dsLorkD9) mv&c;WxuRysHwG*9εf[lvC0G#<*Oy\wERxb-xϴϓufsAff|?ºfD*BOC`ٻqJUTA-+.'Կ<)FDn9|6\3{E*ـ = ^+<\j<+#/JAL× rjq&/3RyՑ#A+L)BB9ma@$)+7]9BPJsiŠ'Z# LGJ;vZ81b<nL%x?T!2TjHSdEP:! mf0 Lv^jeA- 7 gAHu&NikQ!K) 1:u:n?yyIM0$Mi/tpw>1MwR y^f[2 g δOx&ܠfCH@٠Q֍R"nzq;0vhR$w5j!J*3**_*حwRe w MrَYmL;XŜSp#Z:H3VRbg^ӡE]Jo&0r(IGgݖt#+Ƹ$\؛ƭmTCI{ Ijƹw2S݈2%Yh$rWoԭDy/ţ *1>\)nSkCUQƤWْ3cDVR-!eI'76ZuHWeBvBxqjs^abma $vJ%'BDR-9GsP/a|j 5b!*Q I'ZYVƎ)^'*K 'd.=b22gAAҮ6YoîD8łU3FEg)XP&>3iB)VRKk@^K0D)^l'Z `tH)V [f|։֒:+B{EA О\ BiU ע%,w,åx*4lsҶnZ(3|Zclk õ 3|87d;y'/@u0yLYV$j"ZQKVt#HL M-u嬫 b{Bx v1-5 6҆6€J!ACoa Q_V5 0". ҜR}JL]'u;?,=} -^amOMҭc:|2+n038VIhsLOf!)xuHg喻eG@5qxǞ '#e%&rDYSiy>u-l˖P:Wf[} =F J":;i-XR$j:c,#` lo#ՒIkv֒$/*h 7m&3*Ǡˡ/viemɍHbVi\K䝻Uz6Cpq<<&.&ڂ+g;p1S9ۑIg{">VO36ÂrlAXU5SɓƙlBk,S`>TVJu 4!IV;،թAE%7"˟J^s)WŘ^]O).h~'l p<`KH"tң@AZ_#vxmN} 7HJIDM)4zPڟ1AnX*(}ߏ::cHvJX2%mA{3@ 6pHbRni(Tsa"2=&E]oA)s$ܭMB.I03 _V\\+v@ߝNvPGf*Й2IҬ (v˯gꂂ:L|F|ub8:Ap#(<-tĒȥR][PM(ZHmCL6hR\>~ЭHRО"F@P&^K lX\rV(6uH +ŏ1CVu$E&}r)0TN"^F{~kkfF;ޗh"V@) ^:s6UdqTZne);e2I%H撓xZ2zu·I}I#)3A*7Hݜ&)V!թ$JL5b)p|ڻu'UzRVa|NN Uwn)Z'.v^ZfN'_nT@$9XpBSKB(eq9XT\KIINc`/jc;DqKkyh!W3#\1ː;5wu&vWhpveF2[$Q}_بơ,E0Ol$j(_/g_*V%dtTK2QR-sTFPINƶjyāQ֧SiD^"y #X$_Z$&yD'HqE[+j؃6uM(E(QA eyT0l5x94HEu7ۈSEPl 9^a+of^+('. Vq; [; I6-Ilʣ(QGhdGY"@CZz)k;Pi J$.5^cr#ƞ*~͙OsZBKO%$W,t;ѐbtL"$(ر1)!$"T\u3k6J%A-IԼH 2&֭}AV *EI*P#I$_ƴ[/;gSPRX)\zVL>RNV)Lb HR3:8~4MX?I}yJ I%吕ț⚝C&n2x*f iBb٣d>[#[;J2O`a<86DkPH>U+< Z$8RtB53' 0PCQ EBTesҀNO)$= TC$mhT<Ht3@P"/  wZrOǍ;D'G;JC5@ju"nf#ʡHPS~VR{Cp9G[?&lpv-"J25Vl+ 9&'\Lfo1U$[O+c(1Rօ"FKʄjr7& # .{UG+\~:,1 +X4"h8T*-xyp)7jJGUq &TS oðE'ƺQX|i&c/)EPFa.JP*B83n0"ј+.WB}." WgWv[lv='|t'msL6CAΩݡ5Fv*DDIz,;KhqYD2XmZ9d0)@MɑlC2 Nar/;D1DVTˍSm;@W*W&kґж65@"9"SoNB]slx|N)7\b~U^~F'yqt iS uhhq&HJt2~qLrQ'P/[%O =O da=奎UKcj :') dY1#RdK&tC4weu)VPUDkvqyQ|KXUōH?JXrI.E[m!š+ U 5,4k(s~UC&X9{da:&__ |$409dynۆPMwE6n뽴 -+Zl>KcP}ó@L\vkH޽(Z5H:uÏ[rcg>2 rL}jk|ەq{yUbΉHuv2k#:qyXX0yJE؏aŤPyItH*OMV>-`%f. =Ց:rk lJ+`k$VQ7jQ^%"ի$En0l8*$*{'(xIS ]QnN@QC_r2cCdeh=Yh l:\%mJ-eY"}-Jq-bPwOuCsEV->PNѳS+f͕ RfdzS.{{006 Ss8/7NIp='QQL Pॶ'{PDȿ1Ud\Vv\)o,ĉʃ:"ҡ\XHJ I! ΪW=dEw{KJqDY{ɕ7Ftxq1#귒um[;G$LH69|dyvS,0BC[ۏx& DE @J`@w7D^R 5JƆx 6_0u9T f p)2,yPaDQDAPBԨw3LHl&<bj$(BDiP"jKRf(Y}Lʵ N7`hHhs BJV:&(a(hæ$j'ӥhF:3j$_R{07hi/`(!v'/nz#A>1=bl ƴHCŴH(2u))SٞyƵ(֢yTdOK.cYN#\lD d,x ^gig[I%w~Cw^IY0А:JvBq*ɛPӸV{8A^%:~fR#O$0\;> $g SCUWẇ'+ۍBT34Y Py@ ӊV .rbcրDFQcluA];7S@g9# N|&yQb2 ACYD䛀tY;UU%IGvOOtW4r^>Ukڰ8hP$yzJ:)q`\('DuсGj!EJ&O2Lsrtg)Y ٬y;G DQm?m$MJPr $Hޒ8Z[Fƕ*݂ᘈr$R$[ ȐbՐϽȁq3]>2dit n;ooXTÐtyZ| )m2WyzNc}jdUv6'(Y5+1n))$ Oĝ+'h4qla +><*Cd_Bemq YuKP] ¯RQek0dZ_૨xeԌyB-:W6XmZ4AJ}+F3{[!*o·zצi8 < x8'.e+Nbʖ Wx-**W:ׅbɶM?|g A)'v♛=.D[_Jn@+P I%&tJOw0FZ:T!}(c +GwƠFk慐Q%T!/P A  XQ މ$q#@,A]a̚<B tef!!A0  xSXQ•}'ƉT2b(io Z@wqm(@9<|+y3e[ko].Utk۾N3\,ft!7q.FSp#WKg;\ !)3=[6M GCj=bʭY ؗ 6GCظ\6{c{PuP$M;SKI;Q2C2n'XV 茶.u}LyFSNm$Τ2EmR v6gV9s0Y- U[s Zu+3Ÿ,Nm52:ZbtdN#'Q$]26m!p@SMzke@ _Rg`Y&i@n}k^:rxٔK}gUY2t~m{oç#LR~k 4-2;dw7/"y6C&Y/xHg={BU& ;1~Sn *7ʄnrȃyHJΦW-8XW/Js"[lq =95nWL[ht<$̕2'6]LwhqxPT&ā{qrҷ&00A]1 "$*"XTӪ4[ ͩ>gZCP8.Ai`poq$ % ^i=gPaE'H#Ҫϲ_#c܃OG>Tsy3][ZAV[[ #84x"'<4[dbTAƪHv40LPMl(R`WIA[ ɟo}v{# JzWKkٙg *NUEm('l:ڹ-=xߕ,&2:) p$  !H,$ H$j%meP"f|6PGWWfؕ/ַNJ*DQlMkd$7R x&W7l(m9xyORXyI CP)79*ug-A9gN4'- j%N-*R ҉H/( W+?׏u*)‰а $ZG,p`CGQKDSd£8pw`rJ`6j$oQT zQU {1:<[@"@u6Gu7?Jafth/BiIڠ΍Is,Gdϯ *a.$`64TEi`P% :Mt7Ve­kAhb+ ̾<^brT4+xQ|ݍRa9t::\= ݆1kLa D$ -\s`9vNVیDMiÏ^r>[BZu(%Spkj<eyҴk۪wʵ'_3:0 36U J0Ը~ 5r 2O ; 43\rj6Gڷ(va;t"VMfbN'񡟢>!jceu; 6;ELy$XB}+k2W76&4$xy ֠52sqbPmf-1,ƭW\caon.Y5̲$R,Q6q*ܙ&;Oi )i>OizJa[.RlbLxgI*񅆻ce57ŀ]G6ty$](?w0?M}MPQ ۖTDNNdi!\ wfH^3 3!9OŕT1ͅRG=[Bcf:0 1jέ]o#]I{kJSC)WBQ$TR~GuVJf(Vw cxʲ*B T7گxV%n ְ'Fx1jJVҏy+@VRtM{;<KZ”2 MkBEBTBNc4WeݬN=!iFTQkȵϥgD]L*Ez$j@Lˇt7,:Ps޸~DHSLrx$@AL(I'C4@!PcCҡ PΠf$ʇP>їڥ" XWCrx3[oºfDٰ=7{_prч{IPQw#2Ov@.KH%դ$FHK4h-Ue@N17x$k4".&b'  lu_ަEwSB#2NDJxen>[ &厩lFʗED'6QLXK`w\U~eƧ HTwAֲc/HٸAĩD-"VɾΖYe.@:her$DEmU!b1 ;$2Ȫ2pK|Cc$AЕ2+@.RTa0G;j厴coN/1C t&A w@͜3TU"k}k6*+D.ʙ, &*9W n8ֻRTfb9M,.d-60 6U%yK>9`ѐ MbYzv6f'i\B'Ecˉ-|'|eӏU>CBAi\fnTf  *(XyJ$iyLʘQb3?:oq/,R2;v1K‘ϟ,X\*3<ضA=>^D& jf9ֲ:;̈́ y]ϔ(91l(cZRYOv@9*v]<&TPI:yZ\z[l2')M]k>-} -脶$B*r캕Vc` إ8xU]eӻڅqힾy2C_kdj)ЭܷF %DIA4Y2DZ yA mE4T}a+Rn8, BB0E,= Ҕu.=MA/~"lQ'fLxuRKqZJmytBa4cWCnR^U6 Ko:q\J[Po M?]•l_oBR$Iֻاԧ훿ī"'YAXY v18}%.„.Tӊ{Ӽ(u ߎ fi?q4L5',j!cubJ\đ)DM=xVlBwȜ>{ną*ĥJJxI6B? 6_VJovsjo`euB)IK(TFT*|N9*R QQVWL%P2I>O&0)[dDd.y%_< c{9b()D9 y!dUFEDtcZGqYy9fa&ޔkMSlBhE4IN/0ՒJ  rt&g|J&7$f! K,lj>#? w NJ-"@"V/RJIΒ`T3҆9($@i`d'8՘;| )iTދ̬fu]?/yH%™!0dP惖$QD)Mh)A9f#MfJmW&[(I yyt<J_NIX6%~tnW'|+G_Tm+NUEO"$%\L_`O1}8Q[Bc8H*Oq6o#9A?I D)Q]o]/t' ٶC7^UXACQhPVh:3eOl,3Jݲ%D3x׭5V!ԷuQPJdxkҍP,y qqe:cp_qyvG׊OCqyWs+0IS{_:Vm,GKRQ5’GA;$3t9 ?ba 4C?O"&rfHwh8dΑVu PԋXB ơUG PB!ʔPScP_I\F$gYUޙp/ΑYDiT >4@tJCU mÏ,fdHwzsZ񺌊EF(S*w rV| }0D9xּVSTFxW aԵ~\zD~)p ,@)s;v A5%"}c*Pq|*0#({{vmEܺLOSKt׷Jxh4FH+wgٙn"K0 jى2z&:ҷcA# W<"Ƴv)n' wW ĕO+:.ʜDnyW`jϒS3%՞4+<|α ;X*Rb<Aj +<9 >V;xbp`DڣDCJ9UƐcd\~Tm@$SQt)@yYT#֡qƢ~F֌"L1&{RddiT2K 9<SDn#DX mm5w?ea)Y"B9'ItHA'ʁe?<#SDԢ>gH!WH3.N 7#+-4Us+ʌ儾͔Si(AbA+/jOb/B w5(y+2RFdzgiU.4mGx ۯ@Qq7 SCpyU3Ĥ#?zAd:qA Q(G dɵB IΈئԨ:Q[?҄Qe& >J3hV08fk74)9sx*HoA$ʁ.|jp@3;&PBS#[/,ϗ3ɘϕtNl'O3:s).Z{,#3Z@>urtW%jX=s&G EB `@[7c8e'k4"å Eǥ@ `&'I.Ȳc" $gu23"8vn y+Ԗ "oJEڂ qFF|X-x2gZڽNi%it<+Q2>I *~)dƧh% H= U74dn%89K^T `OYR0}k{ilgF| z uW{zn1R5=cɲkoAo9L2֘g,(KtؔƱ[h\2AM3 \( ZwU+.׵{u8vRʣqV݈1 "KeA_ Yb1$(2ЀDxtRcG C)D Fs9 6:@^e&?ր,g*2!E@H-Wd|r$|\7!-(Hq"eLT"8rk𽟨+tQh!g2d#*ūom#zp g bH?)qK`vY8`br6#2Oytw@&m˨/4TPU bt`rfMuHIK2 Hj c C"RWkɚu;!tĭщ[I vBpwAҹW<^XP(ImV ĠOy<Ƣ' _c?K%HvXNNuB~X,Y7҆\C2b́3R/oŃ~1$l%GdWq:eE/EI_ n=:?@q/E<pR|ܑ( Vcmt«Q{S)Je9rC|*Xr{kv0LZ&TʄBd63_lҖ@"G;];Gb6%+*SR|qS]qA%X,)w_~GSRCxUI`-Hrj/苖>!cYZVJp@r0zU>_A .=ջFO>ZQ,=SҢ"T5[R't桸;Cc-l>뗞5/V7RSƲQh=Q{/ [ՠBZCItJH cF m`r$\hU8+@ll_id t%4g[fPM*Nƚ~'ҒDHxU nܱI."D:Vdq94&10lHܞg~IvN= m@sGKC bv)MQ)񮟇"2o_|@bXra ̷k) ANo-/3B>jDƣc[/V9鑣$B"L>#]>]l+'NQZPQQ&>t이;ۨlO$Y<4RJ$McL&UaZa-2Lػ<Pt I-U"V#o$%89΂U[uhRIAOj_FxoC8e2w Z1گ+ea[M\0O;1TP_#03WeUXIjByAKI(=ܟ*9iV*Wbq f [Ӧ_3\.('*Pg5ę3AKOFFI poo[|M<%.]_#hm6/6_fA YTpȤ\|΅m!!&[\)Iʘ̠ jAρMͰuf '@66]UFV; 68x v˪0 Β0f +{7^Ⱦ.XݎTIfJfΓtݍ\Q)zme*1\22I<³a ZPHEIiYu֌ P(EV{ލ&&) i:#!ZA^Vn+7v^-KC*JQ݅ 'NrS(wjs)1O^OH='7T%|k1iv&yxs=h!("2>#Q  &aARD?0i<j񚈇D4H"?* X-RH#E:`h6'm_ddjO`p?ӗꟍfӣMRBkAAyJOJg~uC8`l>&B=ĸ1uJ(Ưp3G o\HA 4hs[dm_5 HՀx)FC,*[MV^Ee)LL֯4#v_3lᐷi%N\ pg24Yܞ؝E[aA•%֊bJIdv x.Z ¶RFvJPQ#8Z+ݬkx͕HRM)5 LΕ"qԲ.0ku'N*IHxK۲ۆ:P)NhTO;b썑wYKkXA$֖o-HV#r8BYri:jwVɢ aZTC@gNbď j00 9`x¶/{=[J.Āg(kzC2{3#[KwV|jJ/Яsج]T&Hrψ1=(' ]Cm,ʳ!I7 1'`w@dd4Oj)w-XW{ QO>0jIYd8$ oP{8Xܞ4ۥ0rtb2u$>eQN W1XM&!fpN-`%QRۻA/; uJX 홵>4۪BɎ0%6A JUGـlS~4P߅" 1`Nj"y#iv0yL99/w9_$|ke/ƒ)\jQŕ' [=ot\ȑgGo5S̗ uH،b(,"[+ eH\S. xU0jpY^qi2!Nv28xVtzZܛ `LЇ RaJlj`Hc(Cb31.G2ՠ]`b &FY:)2 u(-F9 P/'~ {wtWK&o׽:ּyT|5+bëd2NS٭18 Ԓw\;3(ɉeॉ% I2{Z„|O٢=-6W2IL BGT[B~x%:x<,ToiǢ>(.b G id蟺/AIy͜k0<Ɏ`J]ٍBV 2 +;QuJ{+\vpTn]1Tg͛B f**\HrMNDQc08d,}-yYMSzLqmw]GwohB !7Q &X)g>W1i]*l;MBo ݜnZG$>/n5zf]i]s)aإԉ.'A?{A֌&=\ac[.)=IŕkVwKYhŤNj&e*O1Aa Fy]l-:pę( cͷ}y[s( aG  IM-ɹtCp)J3h7y.ŜL u;B} ܈㯅t#E\W%'k y@U'z Ԓ2! Z̜(.@ұXs *AcO("%*ůiZFx«5u=YdB ɴyƒſR&069ߝ`nݚRX4$ئ@:oy7U;heq"&%$k"ǓA\fV $ib=kVc:z`_cB7Sp"&.}uz g0mu)R @b^U\6횖)٠*q^$@96EQbya9Z֣@8$s^t (HCF*m@]d%B: ZsMCy(ĩ EB$S P%G6B? qGAP"ʹrA@pA$x_ʡ:6sA $}ET@q3}*" .5uC%4A*" LE}hZTUpHUNb.x֡cxeJWx?Z:VEhV=aP5)Rx4HݠON|.)6$V-{;ڣ dtE&ĩPP$G{Ys l4/;ٵfJuI$LhDQn(ně+"ڝysHlRAu-%ˑ1sAH^J"  bqڡI UKw[;\ $v5;Uą7d5i.Ԣ S&&'jM-"10΁3@giq~.[t vNm&$=5c4Xy_T= ߦy,PV@cx֮ՕkWEW@_dʥG՝'DQB@sXpd[oh}Ǡ´H~]qRvӲ(t|5NxjV>7[xOgcStl3?xmRU^|/ i{{**!Wv i); KjT%}O865,TeH.ivcEIvq)1:EHT![6T$Mlybes=R٤k*OΔ8$u<,(3 *L%7N!f-EBF'J\d 6ʌ270 OZ8|{/䣶ٹ/>S>k;JL Jnƶ8zBEA mJ2  Fi.U":0}֖c u "IJJc)&c²Zddl#mVB;v$;ro*lN=[)Jtʦo?|o!KMHJ,8<1-xcvy*_bvöCA#*3x*UǫhmIGE*Tm+ &kWˡ/ L2m5N?.) P ɘ=*:L[G[q;Ui)X_t1ʞp/px}Rˊ q?V#b85D[u\?Q8'ɝ̃tɒ#VE91Ȁ-6VQ K/]dS;LOy"mܚ_$@asd6D !ZkUғRUZ!Z RR6 &{u *7%1oʿ-h?JGlf1!@1yMYZ^J.wgjlĄ"CU/1zxApou$}= vAͅ!>WcQ'itI!M0 eFAyU\}JԟV*ei#QPsIإz=Ɖ-N:ADYIԵ! ƉSJRDP4O(XlB}@͐γ$[{&+m {H( Z@G@ :U6Vmlf9 ?bE5lc+lsn;+,F4t$ )VK@ p]P3ګom miiA[eRP"CrT ~5E\cXpZdq2Rΐ >.ޱ'$zX~vnaqJTR koِT8 X,:)VUeUȦjEWDj|FTMYT"PzӨ[JQ #TA5ϔM*V;F vjJVtv~TZe$-. n ֱ"L6{u5fἿ(A cϧuүrCS&46 z,ƶɕźG`/: =[99qs-]&y؏:ӂU*+ȶ3Վx4z5Ӝf槳v0(nBA5g.UĜݛK0yn[. CKO6YM %':z#ZJ2\ oKA1j=Ӣe]Lc7'JW(X=] ;5(P ^(܌x:|ƴ w)84 DcK㑕 j<8Mq $C"G)1pkY4EjBq^I'(к%ӂA>S}JRIA1Jش,e`ǬbX@y?m:ʨ%LJN{g!H[CRL Q1wv_"hFڈ=e$\\ocJ2]W"z_vxkZMFcK׺XȂJI˙*onSRF]-0cn~ d'Si1hʒakږRJ3(aqsJ6Wa *A6J&z4;{xL@#!OTAȨI8 ʼ*;v:TTkl'*J9UsǓ@%@WywZi]]iH @('z83*ZOuЌ{~qP P؃AˍysݾCbCIRI&&dJLIyao,UqY"E !aΆ Jw09\zI)IKn ){\-ohpi[ R֚f~&oشYL ʓβ6bH>Q 2xѐmӔ'Ԉ(+[pM1V#n 04՝Aݣ,9l|hv6oH^갣S;0wU=94?ݡ7 cs~ݡ,oև~ݡS:Z?dbȐ<#v^'ʀų),a;dQ+f"<U7(y)ŬJb2ҟĩa*PSyoXqZct|o T,D#EL)GZ3AHr`V6:дإA@xVQM氒Ęo  ,ꅬuA\idu0қMU\vizDOrhʀqKj(:cUFZv}Bܯ(m Ljbx=#8 ԉ :QN&Ŗ R HUGί$+m= J"ƨɍde&é[IRMħ[ ueM1[$HGC kf9,KKKYmp%"y)X|֭"p}*!+3&=9Ǽ1LفHkڔ%9H:S`ٸLs rP= Ɏ+d$s)i8T. O.Acht'B(ӡxR&vQLo`&*Ygzaǜ '쟅bҗM"mS9R+vFl.):D>1kHA8| &}6aA9SW2g]9ɍ *~6lhHڞQopNE)*owbV .Y~Ąh4(jAO~zX*2q8J% @/rO8)PҺ9E#6>[.wn 10L'F] jrc[w՜NhuρohI(b7LbdE-Q0TzU7ƚaxgE7ZXdC-ŀ*>"ltΐvMfh%֘;LJ A#@F4?h &F/Pج:Uh(NfׯMƴAT68"R#.ZD%V㷛1M_61J¹ҿOpEqHHRֶ4OzV|LVD~5@Ocj| MO!WG:>F[t qU E/ȃ"I#bpVxiIݟvffd'Xi{3b;KO-bSR³v[S 9`5= Ҳvo1v^ U:tcIkOGdy \$MBK*zX9€G\Fo4xE^ OB !P &FT 8Z`(0ܞʀXF](lbƤLj!EhD֢/DT(N{P#9LڀE? RI$R . b~xԢCeyP䇃ه* ~@:PjnI~tug!Eg  h%M<$mO˝.mנi L&! !E_~yY)&,I5EF4 MS>*Ukg& px V)GO%cpxRj" ,(Na4 "Eģ>1u$\j1W6{zU|$,S]AbV37d]C 1$@RtYޯ,Ҫv#PKnBEGJXkנ\lPm80;U F1﫧BˠzgSs'1&#DRĆ[h@Bugoؚe0g^7_NA7/~8l7n8ʢwƣuͿ9*_ { 1D2lB-ās{O f8P qKn4D8R1 &Dɧgm`#3f!+hOi]##Fϲ;?'M4ҸS3 {U8E×ܫʎ~NJBFemZKHK/q0 Ur,%Yʸ|'AM3EʽcׄDUM!EPGA' ވ PBhxyCEK/Q;Pd)-N^&f.7ۭgB 1yU8:D ݌N|B@Lxk4a$%"{a̪I!i\-@ZA :/n"mk}Ol v{/Ǿ(VdJ"uҧEbS#H|dJ6ST)/`g{Ded}%%IQ X偮)v49)B,sJ*pb0 w!D =őꅉ=4 ꉺX`WQKWOrWBXk7m!@|Npūt{ ir,ʧx_i>onLRP24Ҵ'g_VC;yXQJQlWO<~_Oc-EBs\Ah@ `GBNx "Q]gޜ([ AE ʡ̩F/ tC@W{!*_X$[2t+ܞK֔`nHx}RLt;<.+=AFtm{#q%˜zk\9.&r*aĮmPOLHg\@dlC@nc//қ*dMB;JC6[C Y$'Of2u Әֺ%!_8^':fä\𬽡K1ria Z*Bc[I`b@I xl챘9eS>]L{^*R~'OƱv/ǰtsuE)9fjpA8rPpaIxzR8fL7P ìŠd>"|:,t4:Q9ՉJߙ|{©N+  x~uv/ϯЧܕ^[" 4=+n+qXaJ@xA1a.@Y*㏥+~Kw=kQ0 ZB"!gψo{| MCg2_*:\`](=acT3.I@&S!#/4B$BOQNJRBD$0s,ij=*9Y)[s6 ~ؘP5?74ؕXx֫x:Y=BLkihPOŮIB^jlDSp*etcwB0S= Gf>Bo'YezN'Iԝ&jj/Ly+va&5f&X#}O:4ԼEfleV1xI:i-+,[6:;69:6,ZFlsߎ7'u02uQ"R8 ^/!5RB$={ă*(JX c#yR~%d=l:ԥwZ [)%i_ad'Fxr;XO˘LiUT}ClwN% t`&ڞJğlY yA I*RVihDf$x~By#tVc^[r gvtW.gd'[BIdyt2?q@'zz=6R;+֠0~TH)0 <۹Ɣ)"(NP@'T@P}sqB q{@#=UZj@:lNtJƩFM~TF5AuJ xA')*m@" *"mL "P"s(P\We֡xhߑջrٸ9x{"X-6##M4 Ot#r:$hdvxr/*0˛)a&xGWwBTe>FR8mX7oeBm+i3Qy*^PgYQ6@RSH|/$U272 ؝"+tp6$NF0'ңg{&p{8wD'< k{Xh]bXUCV|AVD(+@uCaFG|*ĉ!oN6. 4{BU8~.N@VhDX07جi;!ï\Q;xv #16h !=~ 񱊝GF>7ܱ{!{Po='x&orɭiS;xoS Jă!'{XMT;!c7w +Q;^lCRk$:4E/0T1@DJRU } pc{))))AL)o,qK#jJtH'O]j䓾SGRa_#O^NoTञFh8Evm^2 {sƵb˯PZZTq.@:ߨ59nCⲲ HiYfQۨ; 0PH)kZ٤A:zlM+o6qhSk#y&c«Ro8BBU>2EsWW&qhL+.0 'vmWJiY ;zE64Ʒn4ڒ-]h¨-$bF)h!9.9 ΞlaSmƆfD+3'Ц[D KpJA;);Q^n6 $ D'β熨A18<H:XuUK_W؅jZ'A#lAbj)_+w)/7^r{TF"JR%d J$(Fn|vڍ+i2q! R Q$7(EvZleL$SМ3o0i}Ia=NBot cZW2ֺc^ɟlD8OƃJ[?US}7:=!օO zA`}'y9,.!*J R&"~G֘fk-*^ov5J4_u p$:h<&AbNCd_ED._!oi%9Kԣ]iPmKp H*R3)60{I?KN-m C1 ґk`|~)f)e+mdH8k3QO-܇õЗp+Tq!9G5bf{FC qdlS Hp$C6֭R|?JտPcmVc4YrU@X bxq0` ug)%!`iQ!tk[[T%~0H}`{hΥΣ mMρf$w7;ڮ-2&6»hhh,S*&>uX@nzV@oƘ?v%)Q"!6]x!^er kiJ@YβUyRJ4 l|I?u{2^@MƵ.mZ q0MLrT!*e3LB`\Ҩ],y9`'(:(pgӶ$# :LOhZSe558aDP;C-+o»xd+ӝ\!Z  [j k j74dq8^F2v7@Q@\)o(  kBg(>T9 ! S# Ҝ7 I1[-o3+2HҺ[&j !ň'^Z|듒:]Z3.H֎Lj/6NlR^v-A$Jc-l?.j/]2g'{7d(~"T0&-<+kҥ\ALD~h?7(]-kH1)oEB1!j|G$ Hk3ZҮd).͔6{E&[΀Jۍ$'cIV p^%֢%^uG*/+ힵ\^|<XWyxpҳ$Yy."M@\P!xTD9_Sd066_36lRo><)bAYAЀ8գ [䭌I>3ق<8B=o\я{ 6n1'2ʽ3Y^FD &ǎcR { m-r8˂WWlTā:UWtv-_CEBqYv~QN\c@αKv#BL[!Mġ”I I~j{-laq{N`Ud 9Hc,4 8 eIPqIiKcx ȗ)u#22c(ʷFbvC;PbFTr"QQIˢ#UՒݦ6LRdǼ.xR=tRFl&̕ U͎g o@(Q (GnU. Wׇs=HOW=p}K)"_Q@k#Kї'e)R] JWIUK: .ck] M#Q35g%|Hdrҡ9 x Г eKI}{('⯅e nGH0?X(*-RqƐV MNiWݨt4%B%0y&;OJ(Gƈ f eU#1 bb"BIVCjI D$wG~/Ɣ:{`"nzǤ@qB#2RE mƁ^Gyݟ EJN:Wߡ2OEĉTY^-_iZ~4;ݱз"e?L=90T y׸43ky3֗nJJr +7Qt pYI"wbN-=CD،N)R~7YaEOhxMnr>ttWmE%inD+C/~PbN[1PQYYrOH9bAPi;JWyMw؅ni T;ucRo2btWu J¸j

8-EPĶdu) isʟKޞ- J\@w3!#^3j_yzY!ZҘB}TyZWLyq6kw*+5v?;x )Uu$'y$ס/J)SxE%e<68pS~fڨ0Q0'R4W`!c IM+z}v)l> eD\iGxT}HgkCCw.zi]|mW5 Kˑ).FySnBmM'R! )DLҡw={~z DMFfu R=:w̤W4Kq-1_CgXAUuэ] &*I8:-OQLL+^D4+#T}PVHW,9%!I&Ljt %m s >^${X묽OZ@'0}:p𥴞͆͛DBWITn&Um ò{0!@9ߠ!xf}%k%*I1q˒;H>\nkU0!j8ܸʄNCndVk t>V]US Yh( 'Ijߠ 'gI%*OTVͫWemD}񔸐 yc⾟VUIPRTB1#Tkl?90$@ (9***=2;d5~"^ Ǭ$'(3J)AlRl*Ln# .PAX@cqu]mrY`=VEic!XN4% K=9O&7ح.&;)*Re:rZo}Y_oi4D TIΝhUaNHĎ"x8ONܢ#썴q/hSΚpu-Ն PU8arAQXrAe2TIUc[]#_ )9h`%Ei$pȇ;Ax҄Bl~8!N @=( vqKTLSTV2I= A5ָ X0֯RBI)g,ne"WoExN$=" j?ơ(ƄP!{Eey+Gkrr(V qc;AJK0  /=5#<4 dd?\x,;Ktޫm% Ǐū'@EqNs 3vʟ+c[a[No35Â28G*:_m$u9(qt#5gɝ !9=jvjh&79t z,3 ZZv%^Ql: Upli@x J%* ={B,00Km`3MV LZ1e6gIIUy0l^@Ū#¶y"4ׁ`ݜR 水XQ[qI5D;c8'pLA֞q͙C4Ź! *&!΢!Cg_ i5kΥ d#-BTXQ0Z!֊NHuF5:Qv5)iP0cu$UDIbWP +B*Ԣܲ;i Y 3G..Cg$CŲ1mL*I(;&4oJՌ0IUTSaj f Ud,m!UOɭl]6=o\jE RA=&BLO.TH `Uqt񭽟vpÆ?=+8OfR>ןO-KP]Y^eP: }|k/hKqlhf0ɏ+N/ۘ<&-uW{/.>-k<\sZkQx64@%I"茱LT1DZGc€O:=?vB;d(BeHPD²|uHa!V'!_οTYEf/c:ea%h V#\I\+ܓ7퓐$ypgyR t J,:WAgCmHnqu ϲJ_Ϊy<)>l*;߰?6_E80 A ʮE][ LƩCPқm)e)RRߍh~Ż[S0ݔZd@H5L-Kgb);U { CúR:(K}НؒihBY-0);ةvV}Rھ={\-VEOn6KmoD)3 =bբRʜ9^× Pꅬ$( [4A#ƒ" w;|;¸MT\7 a; 1$%iRd9 dp/\CCvN&HXH RAdºc#\з͸jHO%~@&Z`v}PP!R:i>r/|<@{s"4U10y\ TDFɰv@lJ5k9vo]n=xGtB:4<N=p+ݻ5_Ҕ#8*zRh@p7&:Q)2t~^5J8H9kGjltֈ45N&'΁ J -=G.TY#e^&kihm&FuD:tցD(q*3_*0A Bi9dJ`Pevi T@Ȑ 9@(:"xLQ!{Dg?d o70@f3e[Hhf46[%[to֜X»8WEZs$$u#--0$\$<JhTi;(5gSBfD'uvO*d!aRf ʂ{!'* X]E%g:Rmfs£BoCWCwl5)*J E&6>#hʖcĞQQX,Kt9ʣr-#iv_ ֫Q&5p!W׈>QfO`58>df/RX$SbqEeNI: n0].B;%턞ѵG8YB88wkE@m6KI{ؐ.'!8x|ypRNyW;7'wl_brkA>mKK)4-,bKLס*7hxIPI2@"åd-8ڻ+}$ɸֆH${"׊q!9rb~zߍ>JQlX]Sc*ojBk6hCxӊ0 #0R@>_ 7v]5coIARӎԔ!B$X}*Ȥ]?"ԕc $}r3}@a]hu֌n2ox<ݜX'/^1}E#})jXmOYCw*!$ 9kkrj٫D@"xirCZ1a6œ!&LrښdpNbrohi=yx l: JT.g*ĎFyko`i޿2XpLuo"iaS$#FI>]'A-CϦՂBxQwv.vGHV_;tS[{U&/k6[cHI&.2y@doVFlAʮ->κ a_%*3Iy <"Jy!ܚ`P3e@**kQ+go[T[qP&X17"UEƉlfm\~q=5JdO_%ŕJ7y[ڻ>6TTWmp0wk G;w>fQ(kUÍʑVD>%F~s Evڸ-v22|FXZ!m,fSkP#Z:q6:W'#(8Sd H%3@C4cF6Jg_B3j׈SUs6i7ҫ9eCXP-́yZYj |T=jOFR|( vc}UX0FO ӆ g*)}`q#(9ߠLPS@Zs~54 |j"PGdu>LPҥ@L~o(f۱qg: ' jF !i52vҐṵq#B £DˮP#zʊ#@)XGp΢Dˆ|ci1f/r:Jߛ& Z1xXgKWg+,ێiF!r$ Zx|5eF+OkuDq '*@}fxA֜| Xoi(:J,*۰؄sǓN0+͈(l RJ'[:(=+eE(Gڎ&+gٴf˺Fv˹I]:ݱs3O}`Rh^*4[e/ĪAGQ "rk/f^/n^ HP1~ZWVVj{̓#WU$ v1i@  "/҉AϝBZK :#Բ- ҡ7פTJJdjvAL5p ʹ4Hs,_-<0CP/~u),G 7wB Z3&(@AC4u &'ZF6 У(N)]$׍@J B J ( Dc!GA.1ɢ95}(۴@=7݂td=kL* ЍfSOU熗}q6>p1IOuV填6JP? {JPPH$Ҋ̦.%&k!Є)&BRT=)!GIIQB\^BK ļ`$+*VFXrdKRƖH- (έǏO;Qe;+ ZJGZkuAI)Q$weG! VBIybF?ȴ`Ζ}'UK.#Ω^tXZA`%JE}ϏqvY϶\L87I]G7V0*Jt5;)j,mFۊJH2<4C>FTG:~w ez)*Z$&5]'uc # I0@:+M{U0b4{NЮ&#hIqA Oh%6%\r$߉$'lI&xW,wc6Y ĉ0D!k5N(ю=B?%?+q|fŏ[J쐤'1BOG׍_'&8 pBA3s#ʰ[ɨA~HIC#nhEJ @I4JiR? aGB ZbIuHŅ]% I j,(Snf)e5F?X&(X+')d%%8QB95-G2CjaChXJhpvy! aP3B Ll|hg#(XhʋD~sPË\4&GLĄPoD %di[7,ϔkPW ||9#?s]^Ta7Z ]؉T 3k{i)ŔIRQT1ABH;Ri Ls ?4N 봚N4)) qU.ί~{iEu5Bioq&pf0| $ 4;9/:SBĬ aX{wA|Yhʲ7VL+34OqB2v+@P" aάy]hF6d<(Kn#s m#Ͻ$pYilgG 9\kqL"z )CipDuZnG=ݐEF2Sّ:jɿ3A`^wyA:rIzTsP`Qlgيȱ)/oJ2R{J[LJW{ lXao HpMur]/Mw HrLG`+upilKiŁdP3Z: 2&)Ǝq5D?M+6sk%IΕRdkVIڊKv/81.:T#^Zlz(Z#s¶cr//gf{l. - i4Ooa!j6;$4֬i@{tX:A{pN&H4ҠKӘ'|и{Wg2+Df++kK#c I9O>+d%EvgRF* 7y~ECwKSVd:JTk'֨-kn_)nqu8j2Fg\:oaT֟kx\*i@muVzZD1" $Ѧ`~ҷvVI ("c?h:[IPȇ7'Ofyښ9p]F ƶFs7mX4LmB׵_ VΆ:CزBVSLz](_2L'5i @K$)nI&SU<Ϧè/^ e,ؕ(DAr-:zS%)kob2Uuk8.Cq@%CUU{o؎^$Lrh)Z%YP3Qzdغ["9jH9;0ihd/vv{,$@g,jD}9A+#IY^¼8$M +HE\ {lF܊G71- )w#W' x!:Ĕ֫}4:)g8(k3G(/vkGx-S@$O+18ӊjB{2A~|ݠ87&rfc@"\?`Sc*0Ncۨ(lX yflpn۝t,}m4TnٔSsD)~7jV ⥐F3AR- CC"ss4$u,MqC3(Č?ȓ{OʮJJk ok'ڶ9#5(RrSgV4;CFt&4ˣY^=5QgƢ$SK`f8 9Bs$+$s%3 p8@*B IUsxiTrی{5H$Z֝CHBN)i2Inu/ %SÏ ٖ͗gfp=Mt2$xD$*jZ vg H&;5 /ԷpJCdgnEٕ0ºJ kcڨw ypA<\~7b(jt1V2IrAeYX> :(|(jiƠNLZ! KP oDfʉ JrG:GK)q/G{zkoPf١FgfJu@O52OU;^;y8)5%-EJsEiZ q HsᡙÁu$jJ^ܩj;u *3AΎQ>;?ȱH3LpjSpKkb8~EDI;IQyecIꓨ2e#q)F^$ߙ\iJ譕qD`xUmz1 ,SMqai~56֥/GΈuI(t?SOΪs s6Ql[K @kWO_QR!-%YQ񥄫{ @v86qW=ΤΠy[#߼ZAhXQNp9I1 GK>5z۟ȭ9&țM[BXDsOؠAhN{N qH%yTl¹[CUCՐB3ԴD/x_F6E6 I[?:6NR3f,N+"lH0.tk]}̾vi8&HJ Jfai8r_4[v9T 1e I&/*d<\!@-nF)ȍjgT2h0BBj: f"-Ұ[A2F(CcJKe0yVz 9kPLC}}~Td-2ҒnGi< 8\@"uӥ I<,€H%\T(6I1J0퐬߰(;Lj >ڔoNZ" %O8Ȕ&Y($u3]eL6BDm ˖tMmŸ"zWgn)R HPF! ӈs66/P-Ѧn991.o3:X,ZoEf.!(P"_i {LBSҢ2[܋I̝-J8v3[UQ&BJJ쳼8cu6dz^hr]Eԙ-oNh$=/eb!W X=exl!F IVKMUv?zC[&9~5b%1&1G%O4|L@:]qYdWr]Ju"f|Zæt o:ȐwŷUI5ԝ$@A7vAz ^%"r'p?x0eJuXan'Z68PnʩVfZ5'ʂ)>Ub#]|S(.y$ϟ3ޗsVcHWo>Im,/S?*TvT\V(nv7 )qo4 |k3[#L!Շl`1[HG*h;] !Kr$Lm]xVI%[YFu!KJ%OBeFvfҶC}?TQ.O阖ZBU-*6NU"Z_W߯DM,(Irq *'UsF:InJ .7BLH1Sbd{]qElɈr.l-!-؏i JdܪveI+ܝݣd=A?*NԷLlOj-_fe{|L*$X+[*PWRfPa}*eHT81Tv6jIZSfRb9VKΝ|x8YqeyA<5Km##YRce}CĒDqQ n$o}I$P]F7mp o$aa9AE] 6)k.}e(RfkM+0[‹;K(œ[E q@]p=pw lmUU3MEn.` ϦL(r٤p)Є&A3\nJ))j NIԢ]ȼHC9E*3 6і x"[C8S95F rWg09T8~]+4lLxпPƹƑZPf5%F9: iZЫ!Xĥ1m?y6ZiR@28GVY4:*u?j;SЕ_:D(uu>HhfȻE[)2gU4XDcT*F]y h ѕvdGcF);vJ4Mb?J#M|1=mzE:e&4Ɗ@vT82dy>>×YqTn~=ܫ0W憥\%LʳBO)6 \(6̂R &º=5#QS%"I15쬥0w\H'TwOBt>B3m_SLaAc)tdEM* n?yrҺxre(ZəՖ[UJoT䖕cY4 LʸP48)P|fiIR t;2噲0}zn)emoo%0,:qԚ.X AH:mklm[pQeEZB&53B ҡ (ށMBd z֠AHihpclYSh֏~ޜxh*."8kS.$=n[Tmʗ~b=)s:A'IqQn 1xN@'}Z;AOx_Ҵ( ֲPb!k͈G1'iUρk xW>FOٮ-LX5Ŗb .?mR8𭝞%QfJ"?:t0#%2fb[~ D~5~طa/TFk/feҌ ޻`QopY)Ñ!u'ҸݣipαMlwE 6r ^(qOO0 rx PcJ :v i98'J$/cV-P0K@Fn L|zT{\}*=iA. @pFE1RgDĘqsMmR)lۉ1bb5:DFU#΅1K99 $`1J8$ďxRZLCK@"H$&@7\q[[0{J?X(d!!&mԜ3fDβZǃxt[GdVA#'ǝSz߰Tve-:wET @ȊP]|NS^hU#SJ:$I9d qŠ(I$-cIB2@V [n|[O( ޡNē$2zxQXP#D_iBuΚ"elZ@XZd)ࣘ;P|#J<IILk֠ ȐI A4âW#C< Ia@qND\%B8T!o!P5X:Cmf|/n'ZYBFٲ}ě렮$fojx=kʌ jR%C0Y 1V4W J֔i&A J7VF kMpy=@6TvBd@<9Cw|Hj,QoVdnʁ"yElsJ#1אH;:\f:oPO;Iϼ@ҧ}}4j.Hܟh~߈wB!_jA;rRwB JnM7DS~'؝t?:'t' wCKܴ IQ~ &O߰CGu:='v8ByiS'v!Bm =; A F(wBuQCr[WWJdW?lTK't%hXUea@ VFsBT\4Xgn+O #W262`A֘%Vd~hSJ2L2fk),n]^Tsfa6N @8s'(v1ΆO8c*Gis{HZXӈH `,} [pH0ޡ@:YӸR73uq w&ضgo Ybɥw ey2wA#:: pX42a\zfγRSo7yjeDNUOQjT_,%:( vNL0a-$TڍG®B{(I( qR4+cmXdH %?U%_#.~Fu*tD9@Gr^T_2 )Gv48-Rܹ쌧 6JU:iֺ#"Wf18*\RPH4suIZtV- B"?¶ҩ(bb҇ITL -C5NK4ŧڿģ)6~#ֱ'q2^}Nh(uD\UrT2va4-Y0I2'[V%&}EX 씵f3"`[om| +e%+g Ek㍽K( Q!ph6Պ)%JZꯕiWW51Õ=6pYY Ogk~e/oȤ[A3!yZ* 1S"DlZH&@gMBP`)H9L}JVT(PLHŪdᐌBڙ9] ̓f>TۯqNbB' eh{Һ/s\~g05cv>dƱZiP:T!EV!ZHAgZ wjPzP"ћT QP [ ҡkLA%2>\YPM} 2AuAIS^Y? j itBO~A(IfRO1%@yޔ"cCAji|5AԜb<:,+ u)_VLT T"g@I *8\] 9eoB?ZXuq֩͋CWwL9t=fdi= b]k^&dlgy𬙢эѢ =υsR]M,nHYq}J&UGD#[!}GvB lI 2d[X%kYjBR>vi 0[J7b26@$q 4tj2" k%&HJ> 4b&3zy'x#-R ⹩:M4Fp1k'C9PD=k%үrXpc肖K@7LLi[#(|}B~%XwqKXD%:˽eKd[.DUmw?6_ZE%'ՑZD{"N?0 *I:f̀zX_Z`#e 5=:Y? )6 ٸeH76n;'D|@aB61yR>U]H1ÀB hڬ-D_ylj{?V!ѕR!7'^Z*+WPu00{1V iDz,7YKIkqGBdҐJ :!n &f%J)H#(X3j$tA*PP$W*Mj\EiH<7!4۟GAn J 3='45œZ̳;A^轜H:|\zt%6K~@8[.xp3a^I$ wH48UޑƀؖP L~0H=MB 3dLT }g R|xFī"D8O+`E{TLvLh˹lGֈJ\*„dJ 7f:Y|oY(J|k/37. yqjþ@VODžw1QΟ#[? 1,CCtm,3y'~8FA%-nxč'HC4,!G݂G1s5gNTZae׻BjʔP[ oC34"2ѡahY($PkaOdPGAB{Qs)H0yypqt;2ilj "ڠ'Z!j$E1Iؠbw Ʊ@k`E?9?l4I@A@{I4܋J`72oDž` A<O‰(ۆDx7s @5_$?f#N&-xi!lDLҖ8Wdy(^-Ig  r&G _IOٷM ^ v#Jŕǩҕ9W -¶V[K;ApUrzjƳ-% Srt˕+UuwJqɈg ?̐~`³-2)0Q<2@M哯~5}ӵV|#ta@QJÄbU_!lsvWbXY˵T A%NY;-OTU .lj{'t$UN㵅; C»1 Wg2L(Ѝ k{TMa1P1PL! ߽_ʰ \p]my8 ! q]5 +U-j,[nYcj!Tc?u8A=;ÄiFG>eyZ!R[mԄ<&d@.s[O [G+m #Lqpg 8t1!{Wx##_~ͥ^ZJ=oskjiD`nbm+ 9U4MۣvP6gXo~;ǩZv1{-=)I$Xo4$7"ǺkҸB7g6〨˄R6d, `:R Gw4 gjYۂ%d_B*P4-=O|'Pqʹ.k ]ݎڧ3 R-eE ڧJ4`f)X z)Ƈ? q@> +ÔUHyy=uq'a7pRPUr㨪=/}װڬyV)(p`†`BfojEFdvWbp7$ΖJoz1t+~–M0AhJtp#Ζi[3ʥEǝH ԩXŅ)U &y):җ#Hޅ´U#XoՓϷ@IJP! Abn/H[~)֔"2/4H,!4y0*WfK@'8%t3PTI zAcE``<v ^ $a kABDJ0nH9VA_JA@$?r5*fDD ?O}I$YHƺ_irVkI NCa Ո*b+" 2oc3[TD7%CBxyDVij*[q~UNN !ɫ P@9ڰR-p'1)8€7Zԩ(\(\mUu+h#JS _fn좯tzwd(s}4ҾK{ =_*ٟ ǥb/5cWғV|g)ҳo7г/Y3nP=+VƱnvlAUN}lXTb8s3A:Բ FCG=jWfbƈ7JRIjYiDsf^Ddw@8>U7e0t P'\^LP䃁sÚWBSS?@"PX“Mjh3=hyL*|B++ RLN֡JOJ$t c=CǺ2PCEsK+PeGs+ltB^ABp1H8w$2ī%'v=Ek.DhxAx;>!' {S\5 1Ia!N I : 5a?@-h>`4񓋴`/OVpYbO 3[R7: z\zw >` c򯃟.~^)*PYQ=|2)}=ׂ u9uWj;ոyjkxɶa@O-*v''"f֨#wvNhDcۀ A,XVhSH|9*;{`@ӑ;7!uC݋$V}h'vm81dڦG:/R:Qmw#(k ?+]ya=g*z qZO.&܏2{u).0sHiq+ʎle݌*$Gt|"ﴍxȁccY#{.sfGOڹ@٭1 (Q.6? lj*m+ܗ-! ^δZ} \Ǩ4;7P" Tm 7NhzC6eB YV返 ù NQc8:+mlvra)T=t5KC.j;85[cytG ҶzzVO}J6 "<"??_HV1$Q"*~ꅏ?Bޅl։+?*|1eebd!`ucK< RUL8!蔀S7)du.6Am1mII-°z$+{IxjIQe%35>QSLQQQ-R!3ȱ-\o&Ft4 4@ϻ˭ssWZYL `  Oh)r_2P)6դxt³eEj'w))}r x%Gֲ%>軇HC_HOīJ\Ix`wJFRG"|+|4R m}#QYz[ $v\n NTwzp;ҫ|j%C▴#H0 RSROsKIFVL@/si& [ kP =-Džd[tBȨ0l*X1HE<0K* H"U~6uEE6?TIF-QbrXLLՑɧqgv$*i#XR8t5QY q6V!3٬PN\`qҦ9{#xW`ͬOd\'.\ITBNl^Y"{ ?uW :S\\6nӍ<4Q$MϑXlBP)bTMJKr]ud^q4H]> 1nuOK*v+ˈK$.rGQ/VF1J+ rf'-`SW{HNlx3e)7R*4O^kK$;F 'CRMeRl=6iz"F GQX) ֐a;`4S Y=NP8ׇ΃ B }ySڂy #JPX HXA(s6Pp4ֈhCԶs^t8=HELD#!3jAk,"zmI ( R 9R-&]hS*ǕB Tڤ4S섈USq"(*-P!"UK4#ᲙJA'ˆ J%D O C*)J!dz9H|( 8@j#ΉI32:V+ڻq:XT#YJ$vk  ~$ #0"FqA񃗘~t<5V2!lJj"xiδ?9`&y"tql,j)v*!%@DkםreV+؂Sy-/E%J10$kDvi(Gk^>J&u$5ƕQ Ի*Z98,&T Ǡk (eS OOb_h\:š>_*@:#yf|Α9u18PE n)ܫ/ne NS[.L7 bPj#"HbΝl55Ї.nv/:Q^xOYix,bZPRJB L{2})^l!B/5ur=.L>o";5xSsHox^ݷJI?#r1lxE|2z] AuF";+c<$/V{h{̨weݖiˬە?ݫO69nwx3-;4MNFLdƤ5͔fo2BH=&x:\uKy{Y_H ӏJ&U" dH 7i$aXX D; ~4<ți4@q,MB }B9T 1Gh%^u%ʀRyP#<FhN) (3Rp <:T! 7A.#=J<<*,dޔH!Iׇ:Ò b "/wNw$^޳PP5 k3 ? [ b&Tr. S@B 16"\|1 Pa'ZRkL(&f&Eih{E*lڽ$WG3etfJʘt—, xRqK (8`\n|:bypjSyTuN];n3)p GO/˅ktb+i3t8DLDYS}|" 3DAHL`m-L%b.d GGJqo .b@)ߕߕ [A6 $x:{U> -S:xw{Pv&{U Is*1i^{hØM/q;j,U TwH!)~1<֛@{-*:Lt4;,rĉt^U.$&|:) u; #|$^zn}ǝNCoC3 ҉ݞ; yG:H!oN3 +Pp?@ETVTwǂu HU2 c OgEZ>":$(yJ"(M}Ԫd>N]+xQ͟%ቹ8xXj'y9IsC$*ʲ W̝*\]J0x\ RJe*Qu2LJiad\#)4kON|JT Jl 1I6:KSm̵E5D_Rg$aʁi 'rBOI7җ_bE631iOM@_DRemq􅲶 Dbq1\Eg=F]m,m$n&i~^z l (>Ul(ON خ$OG>Q1KD$cɎ$$ws=i&< W~+x|Jr( ՆMſB{}3 F)MW"LU 2ǎ l- ٔB2,`FCiȔ}Jt]&`[E !J(A=ofǖMJ+tp@_*xG 646];9jpnDIy3ɯ@A^Hra3 r"G#)flm+2DPb֮9jV̒TOΦsaJ|kii{*q nDUf}!;K[nHbiaHjYq ,YVSž1`lofh%SX0/ :֙IeTRɻ/3( %B,q$TEV7KيiP#(fZj(muR샆!EKfd{$onm)t[hD,[4@<)qdjUВ7oe̔ԣ2MF6(Áb3iy4^9 ElR,"d'ΫA_SxYR 6T3u0?.T~[͇P<i7!)=|*N4~1K[J(R ˚ݥG `>6S *üD']dSVgkb^ޗ H>QUɸѓN3kp3j;\W )j}xwDAtȥf$ o\HEf xpfrBɛrH{Jb){ ۬$gm(@19MEuzw&2¢-1Dq'^Ob m-aHv{|QXIv}Kt0*vnKmr޳^߹g"nRT*ܮldu:tk-ۃA;)yD^ Wߝ+ #-o$&!`ڠҡl7=MXTp4G q7)y`L^]r`n@Gx QoP^%)Uc ?@wDݪ} ƊR~.b~r)+*0 ğ^5#fC'0#a"P$V!(>FsDVD}h44N6ZAsG x!@dy!6 A#!#3[hynɂ=4,&(C)TA.;1qB; LfgN8*c-@Z5?فq)y7J$;}(PAeOeǕe /ҋBP-UЃ* h{oP٭NG.$i+c%{+m- CHӌƽmZ%EKmAqwt8 ]:V\&iG uQl}Nl!jt_ҹ֊UqoTA+ld/~c54^1ٵs|5Ҏ%[29:Er6}iBOSׇYrftq@)dbh5yPa<6h<@m$*$<8 $,f*Td3$tXF|@ uԂ@-=¡I($Q s@؃@* D *NGDžB RcMmPn$>"'8f5:Uf6d: QP{ $j gT@|<YR}LT!„($΅mB _ʠIKY aO:Ɗ!{D\ҧB+ٺ2aFIG>JZVRnm] $Ӏ{BDaY^ӎ` Tin]#1R@2Sn?R(6(4q!(^EsdxҳQ=& ݄Ɣ$2 hI0I!1H>h=lx68/qC*ILh/VKi|",?qWAIYijd{fx|| cjOzNoLз v#`-jlDV&DzEts*Š_]}~5Bwc=R Ԁ#z 7d8˔&Əq5X?hѥN@~DDD͠ޝüSr ibbnyJ> ?V83\5@!zƚ_҉v&9ӏš%,(-G4TŷԻBޭ\n] wx8ҟEZNqcj+LltR'wHZf̽Wjp<(~pwڌF`$cJxTta ufVRJLp`-[UGc;n;gv î@RyyjjQmJmѹx4}לH]콑mFwB$ܟZ(ݰq*G\TO>Ucwhӎ[QZwt[M9)&DJȷKvЖ(H$ˍLxTE;{IaR@jgtv-Y=!uLR2OZ}-I-N1 LBmB1Ԝ_8,r1B|m5fZqX|[k :ڇQ*LU-zn#َJv 6r JI5'콡/aj̥)P _U+K[t䢕fM L'wO1LORrk/exx;[ZT{Ai]NRTd%[ʝFB& NP5J&7Ɩ6 ABZ+WSĆԮ$HH4ӍL2ѩz";=Ե9eb3[2 r:t ֨T[*kK612C6`)#{ڜ1ϡ?*v E/4$7ITCl'e pv82PB]*$f'DG1s5-{aB r Gyupi8Lػ2J^?@q.6$'ZTԊUDZ#8ۥ`S,<@mlEr](ĺp7Zq? )$ #­.6ryMڽ.UI2dQ[*rr4Xy316::`UO"Q`Q#ei] V gny}>3zDά$>J@ŽJ"V|&<o#<^ȋ܇q?X3I2J܃?TeGhcoe m!nj>'Z)9hKI#;rqRq*:TJ ɰ^hiZ@q0dP"G΃!`iP$u9" IFӈJ0%fXR8ِ 9T v)74ioD*;PJZJ8Q!.*F ! 'e'dʃjbݟr:kU5{{I"/ƳNl n2Wd|u56Äv{RRme/*v%"/bEHQv/sJ[adDQl( ?[oփ%1zwO/*4ʁ}+J/\JҠDڨDAFCJyұIiB%V ޑr,JiCp~t؞4@yIƘV<9DC'Ɛq 3CͩB €%-Q)'\D29 4Wi>Bjg8(q֠IXuǭS!ЍfąC*IlEƴP V$# T6-NL#,FiuG+#/7uDž*\y+^PBHVȅ5]hbQL#ïaǓzY|teJFUcBWPD\+JZDGSI)(KQ;tJx1Xg]v5X kfP1s[fWN)a%hٌZUĚ[㡣W?iiv!n2ACLslLRwe6m'g0K0mӅ_QZb 2R)rJH3ko^NmQRqB`0C9ϕ/ ʭCjո(Ieܶ1 !ל).A LUO3ղe[{cgg8bl8AP*؊"l-ȍ{#rUeI6Qbgҳd[-dqgi0;,9 wP53Ҳ|$Z;C)ie(J$Jip`ϝ 4Eo8R{T dk ªqkqJv#mpP"kCZO]eV$3ęRMjT1o1% lQP^˯}#9#K~GκY ҄qGRDk})PW۠{oQ?*xDY(nf5Fl\*U^1IΑc?tZ-=3"h:P3 RɈy~?@ƺ BV!Ii#p*8S). 8 v%Ilǭ-C q4 Ԏ[ˆ +p&0"EҹCD*_r%NiP zrQCK*Tx158PfHpcCW+r`/tq;1Y \g",џ&wߗww AxL=\x]?e6xfbȘC'36A QTYvDlfvͥgG 4c74Pa^LA "=IVy!^4Cٛ. 8u>韀i~wHx'7OJ]E"2 /R2:Je*1ruU׉n{4d&㐵jɌ?²Ne =ؤ}whl6pmPORV> }kOBD-@ó[=UʴGȏ"@+}1[LHOFR=iXc Vܷ_9 H&U˴(;xlwuOr& T19DeJ$ U)1A*:}ÙF/ ]tCQ-E"HUA@"Vh^uAݶaҠFq :@ "l667Y $GO AAIq H¶ZN$Ҡ3pC ͠Ci˭B T=xT hTr oT! 믍Bwp5$\>]hiDM(m*㜇:IJ# >0@Ӆ Gk[Ìiʨ)N P0~Hih ΈˆYsQ%rɘL~Ufem*F…F*M&`# K*U``Ja_C% XFuil+lF9@1 i4:Gֶ޾f99&b)t15l40g{f4=L* IlLTN=*9A bf,f>\[[nš^UjxtHGU[cyuw& } !QN' ) (Wu {>O3&|W>?fg2DjfMb{ةVGk1t7=E]ѕXͤCV ,vku1U2AeB`ĥ3"OjydURx(0LsN ׳N%eZ"< yΔCl7HdysU}hPù2EQTZ$j`P\@>4l[ÅkѰQ>qJ1H37?RִKȾYZHlKAƷc[NՓ EC|m-f&&#.{ԊLoy* 0$7A89I8<d@;}̠ʴ[Mk(9$T D.E@?|jCO-`Ȋd퟉V} #4[ gƊ]E4Q2[ t/렏 ٕ*#̏H3OW{/NgvfGʾMɖĩKU=6n ngJe 1 ¸nReұdHD+J-ց <كH$&A:L75i:T Mdx!hK|m@X,X95OV?xJ :ek =5626nږ_k S9B 2nّ7qԕR@*D:]a 0,@>!1TK;e.`FV NQVw&ȩ'ΫY‡4H/Q,qF4ƃ "U@&F@IFUƶ <¢㤠@֠31֡ t6LQ!t@Y` ?i€ǘ ~6P>@; z ;6H(ٟu)m'҉" @  [+ ǭ~|5T[DyC pO҃ ̡0CLh-ʡ M 0܁ bl d3-A>k΂ (JOt~?GԛK$GJ"wH:\]h}$6@a޽u{6H*|SVnͮH||Ũe:lt1&,H Ș<,GhJTΖxCe9R&xk"&?r2yɶ<u=?=k3/E@~Y M+ DeKB83(&BR (k|"uɊ{A.=*-ɦ^T 6´PS@k} $ߏB4)XKKAfE$L9@:*L5隭6U46GQ/~4g~cd8ITe!1HW6(lEV̢1$&K W!m %rzU%ႀ3G2Y 0D-ՂƻxդscSUBUaO|/uvl+H[Jn mxWBAӕ sT)kR+u*({&ct] #n(Bd@ [|VŶQe`BUc-\vxqEXXwDuZv%~qB0S;Ɨ/)c.@A'9*+m+łݑpHK~\BXB*N {3wDʀ}rkӦП .CM?y-[Fi'YkVL4daF/lf! Nu'6]tnw<  P+^W*r$m ZTJԢ:yMҫJ=*f a_Z{E]S_kjZݾA𻺶 -I&d DT|kb1+y-(aa$JH'L*MiKW(H%ݚn{%eD)QHR5Қ'E=*Nu&Ifrs"HVR3HR/4)#Kz| סimvK!dju)Ue^Wmu~,~4Zu\ Vp"Af^ گJLbEE-;i9a$+imYC2"{(e;2%6ʱ~MTP$%I@8% I{mcvIJMʄ$΢bF0d[5?Aı0j׈> ~ L8_6=1'8pGL}Ao`mQ7"PVK~0W:aoqA:οxǍ &1/ma'_JKDL"MO&m$0GPd1@(d1򘙩Pap}pn)+ GΛ >sNCM86AX6.>aX,~[t(x=N2锟DaѴbWxp&o n؅kis6%7"uN{ 8LxLN_w,AH=1>hƤ&|ppNNƹ||Z}ZcFXK`?ڶGfcFG f;t>7F ѲvTP 6c%6z0S8_I6?Ը>7Fpø{@/7JG%36'ÇK6='Sk ~Ư\PL64>tQ ؘ8[ʆ~dHnS2FA9%@ o L{[_Dg{/e*@r޵ptAQP`Mao Xˤ:_/q8$ ؃Θ6#97רX(se Uet'N7/Rrixe%%0$<ưYm&/Ӆ( mf{JҢA[2ݙqN溋s =*Ԑ9M {l{,@KQ7|k|SV.Ki-JKoW^l0U{ƺ&~h=غ?ƹ6+.-ze- U0N}(N7a-w@#@&5qJ  PV%h0S@ҀHk!(6,'(iP@ P @qB n,)bՈpM|IWWq/ X|˂/a>Oમͨ^R |Sc[P]݆_9l{--)B 0wXҕ0\N's( *L̙&o$SglGNW6Ã3}/Yr)j+A>}h k`6:,QǝBa#˜SAJZS"V>KbQnωx\pO/*4K42*iGҠGDS̈0D4@0rڑٵ> Gp d)4A[/P,IM$$(d(N{!-֠ isLPEU&4X$ajT1PLx ?ʪwZ`h:a e`Ds(4dGu;GbMz7G2kr^S…$M\Z=Ɠ>4ˁaA` eQ&Ѩ?j Gr׊HyRچFtI5.j# uѷS~U<.UW_(X 7tĐmGB8sМEfe-.SN)!&E¹-t6&dWڀ13`3NX<~BW19s)5j8R&2X?D}ɌFQa&ܐ`pV-1$,vƩ,- HQy)Eȍ4(QFHŔIT۬zs=HF$Cm6xUGۜ2JVV"$ɿ>m~Rm~HZS0D|鱤+"ccF'@*HXje[{MV&)5Jũ35[>K{Cmd%H)QJ>s\ef3,CbqEE$I/áE/,} pae@Qyzt\ܽ !͚SĺYxH׮hi{/FJ!YJ7'(w{.vsd\5N.(bj/~KЁq/pR\ʫ1έw{ j8&h-*^HM68lIE/;2 R%P9VjX=m!F89 V|SUlkgӉy`#(P9J6TsȗNɸ(POf+E$]ƽ7A{2zy`k i5~9TDgtOdiz=c^ RG}Ig9gUkSi*+m I`<"~G*eQZ}7S @NUH FMLBZl*g &7;$5.XBbNxv~ϔJgKOFHEÝ^r?@3LuӝT78'6\^\u /9O3klE/}=RdcjahYn e;l_k.E xղ/`9MaԔMRg:QF~?G}ԤKZq+lFВND>'ޡJ9:\Ԝm='s+i[oj L_0sιZ5G6F1+ám8*AziƖd 5ä$b0 H'#6iSޘ-ʹ8_x$<*h^6!}+ bxQ'E +ђؔmWh^m"1xa[(KW} oqx4Nʩt_p: f?ޣDꆝ\f l1\4t[=3r^Iԉ"@$tт# 3HR)\Wؗv3xN4G%m' xQҽ-T%Xn  # QҿqNHN9#@؃̓6Tҿsm*#@IQE~*'lOb_ܗ8czI:k/^'n wCI+[d Ny/mͺ@ :?~$@fC~痼)0>$"iSG5{;i 8Li'.4J~Nm2LEGU MRWKqL4_&T gHt}ɫie$Dv`mMoH&?݊ko ݿꮬi;LJb}#Kݿc\:f1O! >iԽX{LJB8}*DԽYoFC̈A*wORb]L-Zs$ԽX·DSfa^ƙeASb/GAz{ 5/V6KR8˜bLsv/C`^I1ʧw/o5qX} g$%m*fVK{^?T?}=Խ XoH"!hrR?Ӷ1ʧw/UyɄLO֑Y} v ۩L3GR:v KȓڑMh{m7BaʹĩB? xAlI4-zk'hދrpchЊsnNzu,!␔H稞oLFէ%&mU~bɺ-&i/ӝ`fhr>K 5iΙ:bhBssV:̹Y, Һm9 -acZG]TMXk-!':uWd叛:i\9teKcO܀9C/hp^< fcD7+lwy@xwL@y!qD12@PB-zơ"&B xg05C ($v.&U E#A!(Gjw D u0fp E[l(zPL7ɲgJA*&J -AIQ5w J;Fh+QMP;Hun$T qAIC6C)A)h(GQ یζh"Ep!_::H6%ӕJ鵎D&*mހF>. jt ޔHqM-Cx oP#*s5ʠhH)@AǍ)NAm(iK aUjNc`hP! S ңy ε8 P)"b/G8{,'Af8kD.$7/(N+"9ʙ @:!OPMP ng֬l"uSҠOzT@^-a`(&8kz4A4Chύ@ B&*mnAAKDh]tO:"EaJ-M@#hX3{NJ)w`G>^(9xQ րCDP']r*P#yKũHI` Q!T֕ٝo%8I㩴sʺR2evS JBݒAsʸ]M-Zcwa9 85 =)ڰ-Py(1#Z.3fnKbdOz#z#m jI(1MO3@1ʚ q]ȘLEqWNbx;*_%u?ZI_ !;%3PȊ` 8sPaCKVmjB4(T{$ b1gM("F$M hdڔ (N¡ 6RY:PRИ h4!*aS(y91/ 00=j"fuFLn+M|  veJ%$HQYcwwqg.|. Dۭ0y">0%ąPɂHxroqFw ݳVxoFz[7p_^eSʦgrl6לy9+I$΃iʫ4$vs{q*VE)@$XNc%{AcLt 5bt'OD{ilv!࠰)"D- 63hMjqsρĨ(( Ʃ ^ m-eby9Q62b R#V;VJ!G*ȂR:K&pf{yIeFHG%X#Y N?G@fc7qwSIN"o]8K;Tlv *@q,k w;|80)$$e2 _i=q,<.Ng1+FtVSj-}AN8_`R m$sR5SScظbcoΟP{ g%EAha BD)UZ|? N/l§.umқinm\qDڭ(`<#1'}JEdd<~ 2F.(R:%>JE6JK/vnaC  1oحpWL*73Zئr8JLY:Cw,z\ Ui?ì#lq I &H "8qzR_G|+gڊ;eg#a hzk}}*~#ؗ=8DO7v!~r>ey}فb$ْ\p)V[M} wقĀ2͎S't$-\B]D~5?NR})+yNަ}ݞ>X9Uҏ}GA:6ʣyO{1x :8yTOƽgAQC>Q"QO;.{0rg@ટD=;&]D͠*}݉s٫qJJvqf}["4:EFfN%c4߈^ÊQA< TSW$aįْ6/ dXB3< tG'vqgoPOw;r*uФ zɈO7'w!g*CG>*÷kX;㉹/={rC{~ؐcO-Uzdƿ,k_ڦG;qO{9 1 5oJ'w)Q- ?n;[ۀ }9&QF؝߹2 x߿Bw}dali\T]^ ķ^p~8 NQ יAKnbGd60Y'K &@wo҃ fdơTOPn?*#9},E+u+*40 08qH(ҡ҉ez$:p$<`T! D!I 3OAndS0ɒH<q̒n: sP%$iB0@_Π&WZ(XtA s-B*{ MZh-LA)ba-VDXB$&$?TI:MZ&Т^Y͒-@N[ $,ʉv\M)YLD',Т ˔QEN%5f\{4j@u;?Lp[ (I&mɈ#'!E'5Ar+\Ô̍(-!kwDNQ@7(U.$Ou6$խ^|*i4!$/PPs(Bl9dH0(P!ݢBaDPM(F/XO@'';)~o/Cj:\FIrT*R4fP * VV@IBZQs {ZDL- ӄB95Y`q@&zWf ¯.Y#{L>#Pcsa?d">ܷ,A.iE;O\Q1ܽĬNbi3j#fT)XTX!IВHsanceFRJÁi'AхԖf8L9@*'" bxc1D%OIgRm m-ܷO)rB[OAXV\»W"F#e[9b S+Q SʩPR핻IKˎdODQ\Eur@$,p&4퇆X3E țe`)JIIJp-  '5fijzX*ݔmHq/6-ȇ L̀>V7<]oB\"IVxYr9Eэ+dGk=D Z#ΕmyFmݠgp*$$in&[Q{`lRPʱ VQbq6>J;*s1JRMJ|PEqK,aGU MDS*ˬkl-W[ h$Ef{2]6#iٺSf  ZO푶ko>Bp̓$,/1<&isԕx-' AK-CCHboԉzqe%ʗUn:\CM%Sok8ު#i͡ٶb[XHH }g&8.&:t>f-~jCu&H814^s47< nǓ^ϒGNٌ?1L .D`ȟ\^8"8ϻU:_e,=l$Fd5y;Ýgŷ o9"aXNUǭ]'ԭZ2I <[U+U}/5TJ[nUI&Nb Bhdwp ,p>S2,D3xՍ\S;m⑴KPH̑ Wiu}ɛog+hwI5OZ\oN%F?Kbx刲'R_iN?T#WZZuaRo 6Ud|7ǩmD0d{SJ 'SyR,G* Kq%(H"r%6X Ƣ%"|4452hk K$(AqV&IZ OVM6gX".'v1`id񘟜"č"GS45xs֛,PPQBZSqjԜJMAGJ@fg Iy I8ǐ1 73<5">Vs%mB V*譶֔9Q61K)FXLeλXDJ/} ՄYmN:-KtV=h;M$UrQm7T4C&-Qp H^xCF/Oi'8}K TDIݲjl֐n<-ZTVUO vdC*`8EOtMpZR2ʠ` ۑ;غspqIf&4gZ-،NbXBZT2QS,n xLJ 7ZlEm>*3]Qj(C:7'B 'v&<;9G;yaFbP DǭC)v 6In>1q Al$i:, C 1_¥DDijx`̝*"E6{A@' Hy*T!J8EB ?PҀF'_֡ SaDRrkA G 8z  q@'pbΠ n*M`/ơ Hfx؁θ|C6#ek1T!ұB2lQdT!!bh<X(wj;|L=Ӽ/nl_&yP8eЏ8#]Oå)9oJ"f5A/ F"(>,P2 J({-AgJSΔ=)9Td%`:E"y4R-%O4x1KJ^E$LH9.:͜TQLFMK Uڡ@p|Ь׀}0SA Iv (KJT)0[a†_|ˆHT"`[9,|6@Uc]C}ZEɼ}V˽sI[.v+K8雊& [{ˇSV E+)dF#QUct[Z+w5&=-H U 86)o {VA-u'7]9i6VwxRL,Ք%G[ 65)N'*zƤ o/hm=έ2bwx{Kyi3_yudNϴ dN.Z"luT:JYR}T܇ HۘD3Rz|<&m*KRN`u)Z(ӹ#2/H.]ͰMK t؟e֯Ç^':mVWh*<֜T.Jc[žf8$n}$i8Vǜg(@G(jNN␐%$$§;t{A#?:;^VR\ ,g ˛ضR¶.5V{c0K{6.Gʲa˧glfgG`m"t?1cS%\MsoxQIs#G>_Bê)w-qI?#Zs/ \<Ƈv;]cL‰BNR|+w 'I)kĨNLۻY{ML܁QY|T0\ǂ?+ַ>Z.IO HlweUUO =SQͲtV! s!r/1 :ϛJl$ۦ#`'ҽ7e Vk`g(PM#Q<,n Flfzct-jљƙn4~+r3y-8p{BEʌ>uڑL ұ^wR8s?*sy2Zwe>+}$X@$a洮W673??qwRwu͇N>¹oN1]Y2LgM)0g6kpw7RUksmiNјIB1]W2${N[1`aZve4dWZ[\k "m56.{děZO{f)͌@3lLi@<{D5= NouR|ZQ0,Z("T@rIK!l K %BR B+ҋ,3T?`i.d8R#7nee\7]#Z"cJcᔗDiҰ/ӄh%FeY@&UWe1pfXHR ky&f9[fάk<\* h< ץ fK8)neuQ@kD.dyP2(IH@P 8`"w RxzT d;/A9ykHktCMH(QN YˠAI"E)PUYhAM `~4HJiF:2/@H)6D T'XfjVkA)*c1@aMw'A掂d"xyЕ3Ơr!!# W?Ơ5` $¡eP5֡#:2 x@ 4ŭQࠎK S_*8@'J  ΃ 8҉?R ֠N2PjD#'eVP{03j:UD)ƀH*h8P< GP2Q(Ia-L(w 4|-.Dx 3tSs0M6򎗟u{?Ǘ+ Aq3)7RUs}xW ro0ݴR#2&`x_:[ɛj iX (fsn=j#h]I]9Kc+òb\lgt`SY8Zi>Ia\LU\ E>вP>wҐZ(* xP-\eđ-p9V˅hί4w5DқJTQ Q:(M3@ðDL@2G8"ݎlK.T8G9 J%b}R)I`oϕ"IUnoyrc2%;p3𠝫2ٓ6iV5Ζ22mhSJUdNneyU2v:{0xhGۘV%ڬ6OTAm}jV%nᔵnP-ZkzWFSZ_+Bj`Ґ,3VRc[5/KWX7cU{fm[J2+7=jX ʢY@i}{'ȌRP'/Z̙gDZmAiL$%Hm.~|^wPջ'0lu0jDzo`^ mSpH9R&MmI Jevmi $.&}] ]- uv\Xs*Bx@i<ʕ-!}0OcCWS=G"ֺ/~ a9oڧJѢ+5ʈ55;ѫ 7v->CYd%HFi@ L&O. yG=( G| Q΃uMaRmn mރp cJmobVCP 6њn $$#j'' $"*%dzQcEL>C߽ I0dZdlnTȩZ.03hyrOh7#h_xi*tBbnis t)*Ρ H-k[oSxWwI$G~\samn#  '<9V|+ 5Zf22N0\Km1P&8AV2IhLh˿WM~ec=]A +'f['257Á;k P$0˥I 1Iظ&IIʃ#Tx><).ovq[qC`ʍDyNLڤUvof#`3˜H >Q1r/xZ $%m4?^cE$ҹF[zwTbORTH jo`Gƶb/ТQ oNeJf4*Q.SZqXվJ-[+f7F" @)<[Chj8]q] p+mgl6lfël)X\x՛[QEZwS[# s|rgE]B~DRxh#O;,\urmS<To3Gimel&BX*$ן*kzw-*--4}/`HˑzQdc[vpHt:ۋ3NO=ü6 N5%5(ơT Bm Vh5@siZ)JtÕBTH)Kjʀ\`ZmjCU *")B7ACv}O:ݭ΢ Ĉ#PAB *B_RKcP 7ֈU|hk*c  D &(hʘiDiSVWPO5&ڊQe#ht4fGPCg7:` R1_P!#L07e%1|îծKggvD+^1A*pĉ3ƽxG6C;fҲ@&ܸR9S8q &e Z@$1Wc0(rrrMiѐǼ`rWm ?!MAYjB(* ]7ar خ`ۈPU)B'm"wQ˝4y6 6A6Kn;^"u-jGfdp<""db.B\y|iuY /+*ûE:ڣiZ8fjQmGX<4gg3#4QVHzzD I#|}XH;8>TGÐa2 5X$jyڝ/ +ZlBI_ƻXg:\{B`?LgdXkX6B$ݝDHf.QTRb6) v[Q7 L ͮmҴE!;p^D'0IΜ(n/jN+KBҴ@8zя#^U(EV!xL#.PY c֘oj*m$Ynn+B0)IR'O Lfרbv^-:bEԥm|u- Hq$Ғ1^NÜ>5 ii?Hw\zyA5v* Gj)iB#D#Gݬca$e) T¹w&h`[^|Q@{pت[ [Z،ch9KؕucR)KiDs q1Vhw0 pA p*֗.h=Jp%RAn<>;-R[ 72NT᭷ZvoW([kY3RG|Jr{чFm̱%SIAQU'?mBòVړP3jhI{WQ vĺqlO:>MRC/ @X Lޕ\]Kڈ JIpDxӕ/"yKo \ȘP~Tz{qD̋^8ZjjTE{iq0>FqVFލБ`PCfOZ|r?ϰ!n4H)ȅ:AΞ6HNbrん$W1d 6t$6#lpZPi әd0-:8tvi͔꾵L:Df^^'},w'!EgBq5ToqHڸpI~t5dq1iZ̭yTlB\b?Z_@m8!+C6 `ٍSOئOfޱҷ=4DM3+F]xLbJ{BA30nWg.#6 H_T(#ojH<OBF0yI>I;ú٭%M("陰mzj0ݤҤr+د S?Z0z[i򉋑ґq>?SvdEɘu=+5o`3قgN@9sZwfYA:vʰ<STe˭^R )~­W Dr[[7$ikƼZ8u)iAJwiM$S@6)'<(CGC}N˳2qN\0?ΰVqm T#[ a4QrlyGs!=R>|AZej9rk-jf{ F Jg,܃\KS4[mikw<ﳏ ^мgXVC$ 3Vof )SeJJf&DF6Ɏ/{4)Nf9AGhvn%HV>*ieKZ{KRFr=GUxc#VG iɛˡz`G`ϴ8nsd^'4|^nlBB5.cBEDˎZ$Y58I~q]a6dw#dsʏ"V챏eKy9Vܑqfl2,!jw]r0JgCc1ZE\*"?WnBPNSvG*©.[ }ԠjV9k]):Lȕk"Rd`.FDҲN'h[|LNsߩ8YmF8,Ҋ-`&3?ژf@ZiZe@G.>8?czϓNeDA3X^ƒd!77)9Pl'D/WWK%&Hzv&A'A70kF; cʠxr1T$ bKcFl Gt/Uv^Xٞs٥#>~52+FH\\鬊12V=<+y <(FP(T!\MCC<6¤DDG/#ʈ8(PN3:S6ޑ˭8da3T!BC7P7tf ʡTȉ'ҁ:[jK.L%0\Ȧg4~H8 ./~qjyabE닏Ρ3֡QPs*-ҠDe@"ܜ֠6# yLޕ8A4q) !ɚ:@6cFRB  K4vDiLA3T n"kj#CIIqʈTlhrjp/*,3^*i@{uu:Ax!¤oJCW M-f7XBkA*R^=G)syyT fHLP!%EҘ OPP'ZBY*Bq"5PyhuS-4[d4ɦ 7\huȰOƣ m:IQ4# P Ҝ,.a1BFe OE!3]~f,[;ZLַ)oss& ?l$m*JLU$s'0"aBBS{uQ:;M\F@Z! fRdq*Ooo/v\E֔%|) m瑏DBN6";< Lw1A\.}d)BD%N?;ֆ_&yP>҆X Dqjo9@"gSlQ1V2S3VGt<]$X'hIA;UTWy+*V42r3)lVΌşBn^U5L~/8BHH:T#8rV}aA@%SԐ4}LF|iRӹz}bUx>e|@2SCSca{"R3*|=*̩^ƟĶ ,Q)dUMmHVX LZr/0%6U5i {j|t#D:iIh$TP(ēBZ m7ԍ )0 =ӈêD *)uF Ŝ8#LꟅ&2/={čT fDZa#}06Te rjiPYm iT&upvʲdMQw?բ>re>bO m+pi7%QAµ:(lF3b A2<&%[#z/b4lI fW.B9&3]uX|sA$ ļIʤa62 GapG t5Ǻe{ʚ ,\ghGviģX+.3eKf< 1UW4dLK*=n*?QqidˢJoPP_vTR 3U~KmhQY{7%G7[l7Ulʀ5Q Ɠ$uNHo%FOO lJvvN@mlI:5˔ܝ>o:6)ISjqAI'BXzѝJe g7B1 %D_-/KEjg(* *u?i"v=uMI[a=vd7xbC,Dm/hk@n(f*l`яfb/)#lǨv)1'y\ mj|~O~"^i=(_1ߙËJƜbs?P>M=yrsղ, 䝿d'L AWd;kQsҘ #^Gz^;k#-J!PA[۵(J{Cai#C\5O{tmY"ZasiOJ.տtݚ9?/QQov'l!R2dI#iʼneSM6)Mcʹ|83Z\H؍[ q:Nl?zk"R9~i]aDѶfFl6݄$'ْuQA1h&upp*%lNq𚫲3@(͉>5HF0"]ptq,7X"jx(,'AWcDkAPPKKZDT{y¡e.zP,j" I:T ħ΃!;HqJ'I#׏gZ8KEQz_K!gހFJ@?1濧: ƕJc@'CkP#JͩB>4u+1Õ@aNApKB:`QJ<t/h֡ )DnxAA4Ρ!҉XLkCt:Hss@(wGP~-SP G  t P H"c R~4Hx: @8zd#,ސcuJڡ͡@LjQ`HZQ:6A$OzZ:'[T`QP!$֡d :2#?J\ 1 uAhOh-J0{Ix ^,76@mҥ[)-䨑s@@l* +/J{L,'Î%*ƥ2ĎD~⍐|:r P3XMB ryJ 8ȱ%y ~jBD@ˆm%iKA& @3-go1R8+ټ,۰{gV& ;ȭR nY$[Ҹ|3C -:JO٘7pC{mtJ ckJíUҘ!ZV\RBBI"3\\rIhҶφfG4s+>_ɲ<1)$ Yr my /7%H)p9,H$~}*.%bTQK.#[1__.ɢ\ y)<+AAm  }%:8$D_&)9(̩r|!,b4J(L*ǙTN%i1 ($̕[%Qm8R&_%K iPa"8Pkt_B9Z~edIh?J zjeJJIF΄[ 5h'f'1#JvUZƸCIҝ ]^@9YP޸ E6x%S)&"->I/0Zg.(=j6<`sQfY`8S<+o5Z|0)Dsf"ƀQ?g-H=EA:;,Aջ+a;C v GAɠPH2vGVH,%y.SaSe:%6Dq^k@˅$ٲ>dgGjaS l2RFW|{ S$Ues<ʃWN5ۮC:֌yT]>:6XmaC# ͬ/UrPua[LP_$ƌUCA+ i#i1Z n59Y;@q_Yqa1 e&Yj-gm6I[:kl2A&5D" ֲRZ bBLOu$CBSYY2Mki}@23ihq\>4l⃷cZ 'uH S͗V7Dxڹyٍ(jޜ#V/"~CẔB$cX,ZTr0T RK-jibT(r zQťAE톘haSrDȏ: M1J9hR 9Ěى3c{ɋ"l!Aش{(똺b^lӈ }IFRvH]H0u0=+ b&DP\P>@Z|Ms2MQt·$'R~BfeN;덞 T& םu1FIՑvNsf/iPn8xՒEjtœ4q,b 2P Yȩ-z ٪-$ZVV*ffS1.k#HWV)v蝳wXV†f֒ A'E ϝ$P[+ld=a! DZԹPq>f'mݠXJQJ馿cPx.n,e픀;"OQӑ℧ml\Fz~}RB4Ѹ' 2@Vtm BhA:Fk~43v]v;=RBz=xV|RpY AJc's",m6 ,JʔEZÉV4(,wV#IZ:}I_hjstRҪi5n)($iUdVЄoDz$|j15Dۛ1b?+|s&F٫ ?CD#{0L#}P/өxdlu5FhUd/E[#+жnvZLVB <Ǡҹ)O/}UWy ;y66qcA b,ަ@ٻMXVU \AO%XB]ZcRJZP#*D ii$'a3|8.!KbK`ǜVUq1 1MbD'lpM:C#h\XRYfu;[ڎ5%=lIּ8U2rBN.K`L2xҭɩBƃC (ƒsgDlK6b&"Z\]e4ѝy]g|䭵t<ZZnlC %)FQ5X$١MPJ٢(1ovpwd^11"d,&(@ILFR>@҄ ;DC} a &H'\1umv vV5BD0kpܦC[ J[M/nF'L-VF[dCy˅CKx>1~"~f ZA61٪I: UT\Df (x5~>hV43 lr$ ^)_dQ7zɄu-xCfXOaxh }ij7Н=L>/v IHu)I$ Xծq\I/fm P,'Hvիk8q/hh  VNZj%%UyE&ځɮSgRr,4-lepd.&MjmUCW)Gt$M-W#c9HJєǻwoz:omF0e TdGYa+WR1LV\ɼs?<bKgc\MJ2FoS &Tܜnvf?ỵ0K!%)*BYN1P[{mGi$%EQ[viRaD" ꬎ(ݬBSRk T WW/jTmpx–Rc$'{aȐ ZrC ?sj ׵qV"l$Zf;ƾ|f262RI<,L5$EhÜ6aKo)! țՑU-Ri?@=!͌N /9qGpj,b-Bijג+#bGhԷi J@*2xiꣷKmKQ5D+ycU,ͷح bhD=8kp*rʳb-T'$_]*pO0cf(Tc.ЯiX$;:xHObB'LzQJ {.*&256{̶/U?гV+ ݊Q?ݝSíyׅ?=Wome$J9TGIC7iDz{?;)zU'`^Тj>ȱQ{?6Ɉhf?cwc!X}QG8gO3ƕvfRʠs&=tbV-gN!ܦG·= ۷gdXe3||fN|h"~?ևNB,`?h2wgN C<;-{?8?Hd:sS-Q۲-֣̝uR &4*2wb)݉c7:ۆ*p{8ZDB|#ّb t3>tf7dl5;f7w~ΗSQdűy@3>E+ѓ=73mˍG=įڛ d]_ CG婣@{=P0_htSbh߳5>̐zLG'v3%":QKfOX6ϑ݌sl\hE/wbbTc/7ݏ@IJ6ߠ;GpW'v-B IZ7%mnbۣ߿B<~䣹R') OGOCwt #/s8>Z=&8@'&Fsvzf1p|;zJlq.u;zB;r\eyT% (_sDa-S\ {w)IPLP%胥z``{ؓms<%xM}G\ R ͖S9"TE=v{d@ƗTi Fٱ }~AF"R:&;u}掹LGQ6`*v(럠4#fq ?R럠RBr JrDmS@ҏĬ~!9h럠4XncS\4Cfl.p2"icgl "x Sԇ7n@iEJI3b68$,7] * }g[Efon.'8tBb4 JxScq#I`A:/ZqQ088bjtsAK`h9H٣*xcoXYYI[m:p D\AZxF;2O3z/Tn@6\μGZ#+[ᔌ$'r;Gً)++/P Q~œZ"@a l"s @3j  ן:$O΁6Nk|EB )T68(sB Y tHs)"@g < Y o(ih I  S N:ƊdžPBx$hn͵ָQ{2o`u Zk7isO/ P "7IR5rmAX6vr&)Rwe494 ϖnGQL$[Yr*kP$ Im€J!3g"'#0S]vΖjZ*7Id}_eVMW4>x kS(5Z": ÕiJC$)hWPQijDMBZ DQ EXx 6€- H)b"ڢ%W4*~*Y41j}TAϱNQDrGG_ZD}YQS435ā?VE,*<"IKgYŇ=>T?;,:ĦBq=|hG\LJ#XS :lRA` D؟::LEZb~xRS lV'v7lBLj_G=߳J }X7؋Bsw^0҇;-^α p&EwM Bf!Cbvƽbm!#6 TBvŷ}XS>~eHl\ܬ1?X;8775&AQLG~b[9 lZ}g3#YFܴ?ݱЃO{9yf :{N{݉Og|1>sucg2߯tJhivq~Ooԏ'vp9qW/{zv*g]s_!{݉ϟ3c?v؝Б~u~W1'wG6x+Đ\k§:[@z _/GgG`}k#қ ݊OՏcנ4 lf`wbո(w\gX(~!z?; ܅pq*we:NG'R3{gvyPϰ gΧ}؝!Yg M֏Mhw|/2y^Z~*+SՈ=#ZA̧뙙֡g&FлLM}4߯Gv!yQvfNq2;vc4]ՋsѣE?ݜN//f'هg$S`Ɯ|ډ?V::q-s4?ݞ8=@~3jo{0wb C /=n{$ B oZ!YSsZAs5c[8^%Yy.ܽjsPЛwp'Fa3z׏QAjVw{C/)| ^@{ ? h- c]8`xrJ=Aȫhqg{3&T8RUӠ&b8t0^mJˢ/7"ՇpdipCBnsxxOUUffg 뤶2SոOj1*7c.=5xtPJsE`9B EBε DzѲ[&cq\MhgQ m$9&8T 9s`rA$p#ǕBԂ P -&DJpZHaEFEaۑB!-AΠY-ڃPQh*JgBbSI<4YP*@Md@#JWDA[W4-Trb#,G0esDk#O 00 #MBj"CA2@#Ei AI ʡ)a&8 MG DA4AAd ΠN _s9FӌTd;MB(~5q3"@#B8M!"UE/ӏDIDJ` Az $n|5'*@h MV 2t’xQJT'(,jJL\B ?‰CFށ> O@" >Hq@R&~HuI3D^<ߍr=?`RH.t_W hUQJO%:84ӷ:S\OȚQ 8 B䁧ן)5Ja xzy/OȚQ!XMˉV$~b+HjK-vW([.(Oy(9R' Ww~-p¾pS jk7n-ØĀJKe T)K*:V}.ʟ%i9{2bmGgXdZV RJY*Lxuм5Ze%ioTYg>ݪW% Lv=j^+{!K9ĥ! :=VO _bR~BH6Zr^"9+n7\bXW}y.[31^BQmb2g)<:M,p[ @lK: g7tِ҉K3RJO TZ7Uhc}vkH[) ̜amIڠbm*)N\Ùap_FFوbsӅLSDMm8GvMʕRZR;pBIPh= 0 ')gZ J/?bjm6p !A)drH&װ:q3M@6 yթ[#9uR 2"04$\Lo¯$іu)Xh3+@: R8ɺm/`Jm8 ,!D3w ӭ rCƣmm-(Ϻ+D[}xd F `DϝW%z/̈́{:4RʺpE;Ol̂PmLu΂Ki.C)L'6>%1Jo $DɰJ-VZMv [n"Ur: E~Jχmj˦ ҰfDʹ,nt"(CҬn"5Jƣ_҈aAvȳLI9Кe Sw_BH Q54nl8Wb`@1?/ع휠)fTS0>+>E6,Hݙ k /U%?q=6s@.PH T\&S4G |Lhm8햢I EW3%ӊJ׳J -dޟuzʎ;[f6AIlʯʗLhIl@W>_J-^?eg[X0Z:vLgY*'SLh6ZF^ u@#QІq(Oepy?p8٠BkdY4SLq<لb0p %)12e ]m]d&2pӅ%'ll˚ʹM3)SfsAP6`'*Q򉩦duzT2jBl d̚/00@@24MQVm$U&KBZ &mS5#xvk@:^>P6HWg1!2̏ kSu!'n˩IMj箕;Rv@Gf|yP0ꈗ7fLX̘r llꄍ5hm8Q2jݚ TMS5C˳<ʧu0Bٲ;x4Md4$eQX(gzs#B{R Ea'oܢ_MQ7fTpZZw?PBհ`jƛy;Ɂp[dp̚8gdQ'dzDxTN'yvx W?T:no^Y$ 5+P}i?~uDS{ˀK`oKOî#^䣗$i5q͒ \5AJ"l[d;uD`%x~^s֏a6Ű|i;덮$v1cCHz=5RgkMLMN hB7٠AdY%gΧu?&np Q$zKɪ'Q{=f {44{jfOd?$ws]@e1IRi6QIn"Dܠȥ$-15܍mżgvTptD ;} AAձmَnv(Lf(:^w@rkF>J&Vƒ" U  b.1t`:h,@ϰ]qVhjxU2 [Eɋ||b ,j]l=j9dդ4/G V /,|NU[W Lw #/HLJ-kx#C58ʧ^t@:Q nڍ&y4H)K<*r'ݠAKXMb Xޔ#9stƔI҉)pcPJ--OPU n!Mmq@zb({0/PdPH7 1Pv)A9r!fFcƉ\*I@"R Q)A]4}y!HB Bi8ڲPQQr;=:T.VY:eSyP"Ä4@qڡaX ~z B(q-(Q u4MydΐTH448vP*y  Kcύ6P#8U` E⑜^aԯ(TӍK (Av>T#DH+Q4@u hFi0@  g rTn{J+]h(AIE ,'=JR P(N~TO-@Cc f,'UOA[QPL4Pp!A3`t3kAʬ!n#5iiL)o Kw˽Z򯃗=jwI&{׭r'u7ǩ`0c^ *Rkg_:Q 7"ŝq,)H js, ZICUt?-(Y"ozk&b$fZJC`tkoԏ7d4Z DюmJ"8Q{XC绅 'P*r+~L.l?3I{/͏)$5$.QvU- WPD%e$Z/{JkF4_}ƂEU~'I1nlVSh򤛙: U} T' 7ZZR1z~[:+@kg<^X>5bk^"AMÈ*joҶjUVA ;fRv€:s:m]fȕ:s^"#Rkd&M[vÍ92B D=*Jse'j0C )̠J}_m[,2$p-?bʤ EF̗ ^X4e#Nj HU8~gm<1MdP97 -/N\Ma'R%F jjjGS؉:"L}4sԔ}JD͕m KPI*%a9bcX/:{ ۇ^VRZȎ)d8ͭ1ίxޚ[Fl2{: a@ ēymqNp)?XT$O_CVh|n᧛[-))C9)",tT4]dk[Ԣ&9J@mIn܆fA)(y5J/d%RQF )f,z^Æ.l@L}]MJ}C-J[k}Ԧg o:oy3DTZ{%S9`։.IXAK턜Ci$4^9ţ /a)Jod(2N,08tUB9KTj!{@Q2Q*U+Z zBĨvv}Bi8V8ٛor+Iy* ˠPʺx=(cjgݎaP PtG RKac{p93FP@zV."Y cna} dH0/l"fT:6SHy0UaN,v Ԭ>GNwPe+{ש,ԭE 5)bFJRK /Eul 菼a؂ H'M %{;3" :yN[k#ELy5oԒ|vRy>&HO2g_*wI@]F{PJH0̫R7^p6Gr' BO!ǧfE 腳GђA!dH.zU-GP{tJl D&Mg,nm8;Nq )Dᥩao;ܶtaqJpY BS>(-Ml !X¬@ OU+Q;v緇ˆijs~5$_4ڷ\)1!-*!DOIjxԭ~`qx71!N(`񎴐Bܔl?oqYGu)Lf:$METH7!3)u \ZGv'LjM+ۥК6"mod %(eH'ƾ&\PIn'cgRe@JA<*,Rۀ97%S.jHJ`e*6u Mro. |[BPRZHu&/r~q[orM͒U5K o\('qv؇J@5hNn/N%J*) 54vv#R u2x 2J"u;3ZIO{O8ҧ|ۥӒhUcOtL$}!IP ZczbC-I\Y S'Tsqb\ZNPJL&WR[6eK&, 챋VV)CI\$D'Z[DЬϊpt21x^Y砽|q^!yцL j<(z;bVR= I:5'KvEvnÖ>VlwRKQM,W=@+qͽHO5is`".AeHq%*A3NICD8}lO%SsִˡmH&DB&fyVLo~=DS*b8G*r!dG΅Jb9`pJsi8π(ZM{5 h-yB*c+4m$dLƴ$v [ lJkٟ&<[z񮑓vxBu5,P͸Ď\#^Y#cђ=/Uv]( IQ93Px9:_r{G׏I,#_`4#Pk_eB$9.t*@ADVm:T V%B`phu)xWJ(%EODgΡ Y ӅBpjJ;}!!CTt|8*n:Q!H+v"q2&bύ EAΡ:8tQD}a&qPAOJA+ֈ3B %BDTQ.h1( 6AMQ erfyP!AȌm~4,$sҊ۳q@ HBMZ" ”i@F8~DzmI$ HXPҠPBO ` hm $sӗVu,$^@1@j$:a&Ѐ{ƁyHGxg_JV|a*2Iϝ d o!Gt M Ky)?Q#J "p2JlPTHt.(2x!xFP ɷM@^%epTe"5aEu/oU.Mko[<{0zMy#9X{m 3\LʒSQ->087%1)DIHOCJa_ZG\yٺ(O >qҳ1Q!e9DFN4q6}׆mD„ǂRd{[Zgץ3@^i\ E)-ҠDT@@(¨jE@Pb'b(@ ZaD(P hQJ@CRvB0Hf(. a#^2{֑_UC Gޢ{ea'Z5a 3%&FPQ,'d[A8O s]~Tsɬn}9fqdjS2UЬY"sy+q I0f8+5~_Y{=!Banii&tt ^9uAޕ+m,AT$q~_8dg[tOb܀ $bkOMz*E/e~;QX% !K]S-֩Qջ7\;óBCR lf%rLz1\ؿ_JH2)J$ Y)ҫ=*4Վá-&@0",=iTJz[:V!^Na oZ!O"vЏYVJv *;!i==M:z??򮉞`~= 7_LW2kL|3LwWMh43$hΩ<#A_&Q)*Sd$L(ML$դy/i:㫞'!ZxI.WCS Y@@x8 R<`G,╴daj[IQē&ZSG'cvBFo%iOf>t^Nyxr !/W IT)oCХwSjujJNbAKeZS|_'Ma MvM 6 A%Km3(OJzKdj+c) -}'*[Y|4ʦrM#ǻH[XVQ=҄+64~lm,%$w@FRocb77FZiJRRhMWxyOf &71$ RROzc[GwlNI*+t4h}}@Tټ|kMUNn\i̦TRmE:޵WTs%Mځ 9 .)J*uTJVLFz~ {׊v6v=%{ I1i/\ c]N4w &o7s4WY_D^nk(I@w^|kCϕ Ub_8 2x |..zb7UrxF8 | V܎z7q1bUs Өڬ1<8󢖷\Ec;"AļZ9a֚>7vq)otXPϬ$Q,<{b`BK`q? zޕa[KIZ(OEwPDwN1JX%YJfg?P-dV9{vhVxPҔ/{1**V9K-Nq_*VW/s`m)}ZJI0R9&,5i:/.?t[}kՆ4+icA.(A2O?R/1[ ϵ1A)SjM?P-LocN_,\%)O xs77h=Yp+GuiIQi\"Zbq*VlWTK_2?3BraZ^d^%C+(5e} |Hƅc)! TxR^Vv70qjX[Dic -z.i[Xn,e$$I_Z3z|1+݋Kn(@%&~Ti\q|'ّh̨u?y'۟Ca1mI04 RƠ>Xpwmc4HVTjEԄnDoP)r~RRg*62Wq:p8u]r}% '|߉z!f3pᚒQ J*:Uڶa1[e8: 6 FR;|^y.PBmrL6R8V59;V/Tu)BRos:h~%+q8GUm]R`) 'ijg|KŲ!f8 ѳj$',R{20-!Koaj`\'"C RS GΙ+^d>9m ;173iI(O FݦJ }%.H%?m{*Xd}x(^)ĺV]JS"73[5J)١[kNeIGᠬ0^W:C7 \~Ub W_R~cXs 9me jIIũz&oqoMDJ8KJٷ!9,+آd%$@?*-^~Vq~JboKRJRKAI0u[!XNeZb]9+Ңy~XuT1*) %J #1s*'XUsȵ*1rd6Ig4JQ>Vhw̟­x6,: Ѵ?>' W2d^'HeP0O`ƆLZSxIQ9pMyg#E'&O7 ӉHƼh @k¹|[Du,줜v b^J1Ӡ:>o r7|t2CbIkRp6Qk[0//!#=I?яNq9f໒8Ygi~(qXbIa* pN@W}|F>J'kaP*5n8(sHY h8EdIXKV6i.N @1᧕<0 ГyqݙT ser:!\WI3[[bt֧;;>#tX~bFJBP^V4^lQsnnx|RGhqpH,kiDyA::dsR>4Hha$vӅ : Qvzhm#!*$G !MZjW^u!HR oz3pZ` -=B n&=*eHfƀG`ĂH"56!T3B-(9DaBB .p@bbN4fg-nPǍBi9ZڠDA!'B B&ACFy,@'D#;X|!lРج01j"ZfuAÕ5U Ê=-@'p$HFLúIOg8dAwF^+'(u8KT! C2ߝB Ai 7(ʽN 4B"Mu/ |ۺd7ke__.R_*Gnf,;ws,0 ڻV',+S[XgqC Ofbг$_5uU6┆}ZO]?NV“9zRDu.,|j8uB(Eǜu Xsy M7٭4Em߅U=.\x4)v" ]<ɎgCY$<+I֘h`ԣ!^ ;'Z @u"8QmV(ց((D$ PYlvI#nxo |(30.=j2':c;iT ַO:b2fA<~{9 ۞f„r|c򯃙/1lT^n=`pVG멪=La?Rɘ7ɚ-pa0@=tβ-[!l,mW1(Oե^qT|~qE|OxJ`F-ws]4f#RmVvڅ$<ذ)W! U҆9^ANl⟻ʁ:yz ǚ{\"F)+hڤLJՇ*!>eZWzHԵ%^8(_֨5QS)BuY$1e!ümFB;)nI!U BZȥ$Jʆ@APZRR@T]Z;|9؏,;Eh)d!YIVձm 7Z1tG,G^UÎ= xqJ} JT!$GU tqsk3#}: uUg!Еa/cI#} jf;N$d'(oZdã R$=CeDɺEP k=iDXyҽۿXda #Jݗ`vk\l( Ioq"*%ׁ%*meָ>@ήOe[GkZ9omxyi[g;p'3( /F W|ICg;Dv7+_$PS ˢG<y.Fo1 ȟy$p]A)iʜY }f괩GևʽxubVwu CIi\!WY]eJ^U#prFXba=({f1&U~c.m_|`Pqx픈B'A5G:7|Ab;Ϭ@ӝYzW |G+e-@)JOGƋ[(]o nb~*+9OjWitβlxw;YR XӑQIT,G4}Y'JREҞ#+}Au#!{K>$q:GA}C썲FTj=ZrDxzՓ̑JKH BGզm'ݭ+EݕyY^$2ʈ*R7Ppܰ7lqwKn% DÅ4/nN9(ô0'(Λ%Fo-ƒ2MLۛ'K B 92@$ڡ;òq[Mk+m%!eD=*Fqo$%m}ե)' *^3QՅnZhT&}4QSQvJDbյq}- ChIPQI"/: *Ĵn_,^^\Gbr!OdH̳M'q}C~1tv9-~EBWՃ$P0PP"R?R)cZ={ RJU6ԉԓQ->7ׂs#( 0BQEi;tC&@;YKпdõ!J:T{VBڲ,x"x֕TBƹ}RJs( <|\ 4C gUBuQ'RF7fe ,iw"̫>(-N7``m WyjO@Tl'i=|!Th^ e9l!%:: HmS%9D<`ƓU%{3-(T 8wyd-QI?`i 7CU=AS< s(' "Y#J_i!A L ʾuU'-WRywy0A*̔H ӎj2}N[Z8yHbWi߰ҞGJPT&Y}b@Ч OdN8[ y9B]r-`y^)grZ1Cl0[!PG|+3oл͇UƩxH9U 4tr6BW .Fp` f tG ֒A ƪAf[e(ԋX^ge-ׇ &n"k+.C.'12t*sH"&H )(ld8(WZg<fjϤS)C !' V6i-؄ب^9<@X)PcPE4p`zqLِO?Z'F7CF#2T>X38d:l$jh$6\wŭCd̬Fb"z^ 3$}A]9 o”G ^$" FxfV@L= rwOZ T#4xpU0|eoFJA ^x$2/ ^#[^<j@Bm$I5,޵ 6J{Zy t `'@^KǕBRs^iBDu@0K (C$-qBK" xDum<s@T¡f`T9ˬgBtbHJ1%MDR[:iT^M"KJ{1a`1 ~ΧaD8+@PQT &(udZ Ҡ)<&<9P!5rHe;rFݮ){`p#ˁٽT͇m޸|>[ 9%GoQDBZ2^y\2--[q%:qg R~ҫn">F&ҥ$-zS1 b" l;ise1q:ǝQ>KÌN11 uVA-­h~T 6l'H\hq # r)f)f*iP"zx*"( HC)$/ ? _:΂2ϖVfq #+U+n@D4 Lm)QAx%5edX:3]~Us'ɮ%JP`?ɎoҐR+RԳ8>domq:B( fV['cL8Am JUkaRރ !!Y41̏J]Y};?,OU>KCO[ZkJu0B`^O:߭nXV]ꇺ"O^0yUhB BnKч%T"yLkÍI>?AfD&:~$ّw vSۍ|[bEZvf@U2>psnR&\ǔ  Uu$K;, i8Q cIPjӋ,{2n;hf &myMqy;4--2$ mnM?'^Hk;,hjyދjߧpl̦e|S2Kb{k+N3N4\%H0Պ~]lP7N \JA  &+K_[aI9JRf#2’Di©sﳻmR38nMWO#Er;8 !8PR.%*$Vjkcx0C%(qM8߀$6&&TQ CK)S K-e)dIH(B_oR4UbJpvd  Q'cKP9_8QwRlSOA&ӏn;\ZY" *yФՊ>-H[ڂFL+nBu#X3y֞K܍`{L8T|D >F [>B}G @8xKH ĶR;` `/VIx]ek7ha% BUTEX*I=^l7HFwQH(iu=R |bFg*S'$7&OxTn6BpbTV5 ǥW+]?q+j[E,<&Nq!E*ANX< 1V`) tL!Ʃ-$]D sʄ,iKnI#Qsd'\.|#cDmuZYqIs9S =#S+HU wF=j?"D @*h4aH2j@'>5MLnwhli=iWv4hFm>Bi?BqhurFgT[5Sē^%SniV-x;=Lq6֟64 {i;;4ₔs%(A?sVǒQ`ow 9F@ig:_p{ ~U) V?l)E2QI(q :ÊaTDqz+?al3F)pKMVt*\Y-KrF/x֗;viT UI<~dts/q[ ݮqCB:fc³~c%{EΥ(@«y,Q%vcLw$HH9R97JHkҲO5 /ц[͇$-KTlSӇZ8܀V7^l:2nd ߁띾MV!i%)0[Jxw:EX?1[c8}Š(~AFD(.MlF2\d G TnE1h iYҩka(6읢KJ *Sk& |ȭخQ5?D9KR ଎&A>R*Rz"xwuR^yF\0P A?;}@'Qh' ׹|C OFL'hdٸ3 7uv)<ы|Aک-N\+ (^c5 s1Ĝ,?t.0"8U9?mԍI%D(QLQrzm-#c-m8d*.HԒ@\eHsgaRNb&ޤ™ %،V4RBRUL-'?qUIE|ɶE^H ^?򫥟d"VF6OԹ*ZғiЖRw) %P$™bmw{Zœ%{)3Ju(]dWwB֩tH$)yMRŽtILp~BдΦ =yP}dE6(Y ?d9.4Un;Ս1=ܶX&lUR#(풐TN6=RHQ7o%i r2vUmchUp硃Z4\/sؽqӘ)u!HzWJFS]%M.2:wVM[V~B`ճV~5$5&$Uz+IuxF~Ce@eJ:@)=E-N7Hqx6m Y+"Fڪ4Pѕ7'k]J)J1QƟ:44Ƅ bXIZo:ʓ"ǯP)BԒ@1+Vڲ3nj6TutU+N [8;$A@r4Q"kɥ/ڮ7O d똕je:Dv3-H!"A9RoiEV1Ҕef!7LƹM"f,vP|%x(FV}eM3Z*//t4a |, 뺼cKuJuÖTed]oCPL[IV2(@sGp Nr}bf~2-EpeȉgDDPA aEM t@ }?ʵ`A9YBT@p!`) h,aVLq4"'07Tfƍuh BGt{2˙hWSt ױխ+yLV:\U䏈s[Xvj(4 7āKzè}IwLD0c.*ѥr;GߋdI'V4.NŠ#$."H~H{CzׅOt oA+!{hyJ!)AV-.(K^ɍ&jDۅE0s TTVQP0*mVLP 7ZZkD";=g n<9T )_΃^ 5, iqIji)F82jf]4d$R5@H=~uyҁ(qm7(q _*"R$Zj@N!$*:58M gDV2#acAyAsXG)<ډ u3T@&3^tʯJ@Z:fZ# ם@JרayJ@KP \?DvjY@1D]cjMX `A2߅.δ#"Z:+FQ5)DS' ڡ]"b4B9;:[6]jJ G>q Wvy` uŵALxҀFPJu@ 2Aׅ* IA𐞕#)U5H@$-4hJS:GD^@A+ 7qPM&4,ڡkg2"d aGZ ft5t',efˌFdOX۽λM5M?p3s+z5G쭖-*dtgJɵmXl Ob)@Tc*cxXFr-7*eͶp H×PI ΟPrI$R +^I˟(" y֌⊣uRʠ/ uHg<S8 w2LXN}L6JHHo|q;nsu2LH"ffɕOAmKZI%WǺok'BSmB@6Z""B)4Ea:]+RPoTH2A -X35L0֘rJ_l7g%(Tfs@&`„4 >D)Hm)SFJ/#@}R(A)H qԎcog.دF)8|2E!N'T<- {˂{֕*TO#% q2nSaLql**uWM=!Q}ǖ FT iIr!8͘D4U}ITj~%nXH"Ak3E{AY7Lc;Od*NDJdS#NêUPCSGP{u N[*iu1%$ĄOK+%ԁt\=5 N=U1x6rD ))HIHíUķcX%z:q:h^8)":(qT7vHbKbrZExR~ m 8}IQE֨IOgӂx{dn$%XBS.8$ <<8^/la p8/fO\vRlcRӉX`EoWO*p$bXNϞ S ^5^fO4 Y!-'1xM[*RdL}UQA|j䊆dCfROtMr^lũ|!̪n:QMrR tN:R3lғ<՝䫨4g#6v\) _6xǚsJ*yx $@ 3 nf@$q򪤢æʗ}!J2D"ieѱ84jCgÐtʡcTf>w]Jд():|WunocP?*,nH̭RT\AFLɤkd=%.wMBPUB[u&gDlJ,))'RL*y9U)nK e$)P“,di&.0 ĘʳMҮu`c^$$"b'D]BHާew[oP>ΫϓJ'T)dH '+wFߔq"ză5*+ݲ[mH&dH>Dq ]ȚfAԞZGưeǡ#+.AuUZ]L/uE}х%'ێ5QYs@v Ĵ2-NHZF+6UM";Lޓ aOU_t.79nTt9׈ӏfםf>) <2R!‘'N10",~u%sIҠ@4n 5/&8gmq-hE=)G4ZPA"#,GATNU@ #JvWɏ0 %D\JvFqyˠΕ/}(Xr#MEb\";K95_e6`8rU?:/C+]MWoM+nEITGvxP`%A BSkoQxu(wӅ:Ak2E}mLPDP!{_ Qɏi0JC/7#DA*Tk9 k qCۡq*qd>j8lFT@ڎ!<ˆ:P "U$e$ac2ڔIKy*2?J$vbͥ hkAq!J"F?8ڊxqASPwo  v3dB@J &>sP#et) D HP!~9MB SB@ W(y <E 7̬i',y~UGf-j:F RgC@'Q ±ǧZB9Ti€‚o<l9iԏQEҳ ʋtPW5%K#CD[KCNm5 i Eap^u$6ƈ,BMB ! H~srJquP $ ~u $h-@y/3Q _$GdJ$5PH:LF8婈s$iҁgҡR@TI+ JG3 Q+>C12}uLsݷ4MʜNj"1m)(sX(UbBn6k{ JI(Gm-61 Wb R"dO6 Py6ƚݛkhp©,+6ߝWզM_:$vd++eI9ViF&RbSU!3><\\`w$r[qB`D=bJU(jdj̘TƑ]"Ki!I0Iy~Uj+ncqqhQ~1Kޫ,֊Ƿy錣XOg$?xE_Z]HVKVc׼Φ{b '0u'[X\M!րĒHyQᑕ$@<48e2v$*R?>T@2ldZSʔ'6aa@(Lis4'4lK3Nxc򯃛.Mk`,I6p\x2|#LzŜRǾ  8ISfn=5GG}mvm2:dn6qAYrd^} iVB0"g2ZƷ#ًu UU'P4rI'"Elh ;[8',jO\7- m]ÓI* y\κ_ 6/2uC?fGfѾcٜ2\tʕtڗXZ}uaTOYj}d]# /?2@II Vk$&9J̩-N ." Zї.\ae$JP-a~a>nlUcTVR{!fxaLni^AX.Ҝ!,}ԁ \4)/7Л>NH1 QΞ#k?&c7H}E671%Z8!M Zj?<rWqu)* : ʂdpI[n,4 A1G' ǮAxB㍙JRE̫[H̑z2BPN!.$5wE2a`IE'SiK}=$lݔ)vHRry1)-J"I)|@FE U4{򅑛?-" drkS+,7?.!@JT *":*&a;C{]I ѴTk}fQNRayy@$L|ѻ7dZ0P'X)Poe9RZ:U e*& x[ XGy`\uP&!IfoE˜ ^I&kV2WʵY>QI@Z8w4@> I"Ýe&/MJP,:[Z2Ր${d+zxTـl223U|R=fzW?ߏIY NhhJWv1 Ð9څXP"L@p` ҖxsPzT!Y}iPŴ"E/Z$Zs $#kiQ@ǝ0Π &QL <4q"jZȊ:DT M ޕ/HPK{AM97EjrljRۅB LZ IkTaB:4H:ؓ@.eBQI@a"#nDBāqœ*t4(aN(Ħk)"zAdyiRuHby'(\#ƠoPaT@3PGxQr SbtZ@=#JP;N|(aB3 γғhLDRBO3T!c6BV;Q3h)nu\`荆dq[T@fKW=ʹ4tX;ԇ& :՝eu*YjSNɩ3@uq%"Õ&ԁ^Ķ.ܓ=_VL:1*(??-돠˘O< mHW8>|(jDAFyywMDԙ3|fQZV>ề^%։z ^r3TdRmYFTɒ}=(zGg*Zeʅf28iםV DaבOMxOiSB;cQ6MN؝D&=t{Ͳ3Fs(¦[d6D&2+eA TelNʧW jRø}{T6aDKkI8V7ـv-@djz:n$Fb<ֺ$fnsٌNd3r1̚fZ i)*sN{[I3}?r}͊@3J":_I:0$rܳ{2-T^\`W/_[1)†Z.0Tba+cבvw-aE㨱u)1U#_*18qɷ gV.c#Ԏ3T7гN < TE,Lqʴa5esٖۊq (!9OitܤH$ֳT-,71{bTt%G[q:I}mu3I6 xUwH\h*SPM+_f{ljlk$2ϝ맍 2?iY $/E ueNU+*R$#›JI^a*٪Z;{$o$|t>I8u :g)^%;HZ@_c‰T:z=Wk71P_'Hŵ8|;D7^IR$|+rnC!SXV5O*&o1# ӇJy#De1aGOu+TʛCObi N^ /Qwuì;7ZJf,´l4Y1N,FkȣU%\?퍚NZP1X:ڃBu^g*Zũf f&O~CW_u*I)p%IN$ rk K;_-J JER7A!j'`3(%Bc׭t2+e4q)Ug&X"4]8FHY,7+7>N|nyG :hFzWUԎ9+p$(|zw{p@'zq8%!ՀA\ұǚ*ren㔔2Z7*jv+*-$\L xWKZ+x67I.O|JYTI؛Ih9mO4cR }cHQ(o$Iځl$ͮ&kN7{ -?DoeS VcdPv"vmAJ2K&$tgZu=l7ٝ;Dd? \TdgXrE(FnLې[x){Ns=\QnVlmB[/[DI^8*wnjvXl|{ʱkH q'A@ yĴVbF%Vb\W h8r$0lo\&45a8ZB:b0ѻK%Y)R `eˡRҨF%m~c&mäC9'(m=xγB-B'E̩QcJJ·Dmبʐu'Rssdh2fT\΄^58֝LzE+b-H6 2PR \(Z"la.zx{߉ڶZtwG_: ܜ[mxQ% xO(|tɝGnF6n`O(/sCJR&DLv0a-IJ58ьb6ư[CJT*BGRJ&/RJ1`V<}NUB Fg{=9E.:!R..{АOV\$vE!aŭ)ʒJWP,H3I[-=Ң ^F5"I^N75NAt!iySh1;%:J`zl5;[62[JFr.`v6+ JCĕ 93-XSүԲlWN!;)I0E|5M~gUZ?f^&hpScD'ixDBa$wƘ>0+N.Jfs¡ d T9&R 8ah!*W ֱY` 3 ؍' qG^SM¾e{3&mYׇtSeq-1Qd1tT\^c[Ld)Œ.*a ^P{ ~zа8io* CT5ʹA?wqI - PL 8DT,'S.E;0' -PʀO8TH¡ YaQQ!Aq:-S<i7٥j@=|(Mi冄ΣT3s5*BzD*8#‰%VSjPiz AցfqC=T $q@"]NoZ,EH?A@ =|"V 6j` 1FeIWåK!%n^5 4r@YaE_.2WpPH ^ơlG@ 0o#Doا204O(NN&>DKw8PO 2OOJ:$!/E Jn<9 Qu)MQI%8Ѳp =h#YAmBHP~;Lnъ3yyPL- s3!N)ؕݟD Yvo4^ٿqO=5zULJ(. _)Tu:<#/t IךV`A]!Y $@kEVlmؤƟ&=J *\Ta7r[3.g bd€ 5~4'l DۧWigŮ3xTMm9񩥃bZLDgRo.liݲM-LDxIB5>ls X*9Rwmlm%!`LUdbэ>6fD*TM/RPly+o .%* :̊q;ΰyVUNtdZu4oRV]cԽкW*]q]bnt3k4RQ죆#4_(',^ ƍQA "6e>T8!zP*@(PpݨI" r +g ~ɶ%8 oh$KZVR jsiHɻǰ[؁ *u@?hcɯe#ْyK P$UV<6 V^v$\7S7+ )$1}ƚP`cZqlKvo6ki1=`)$jS֨-/KI^'z홄<< JNJ/O272i I}-&͕m6Tҙ\~^ElyęejKd( "Je~ lF ] ߍʶKR_7e'T"JDkXbp"eF ݜiBdbu<%EᗱuwcڴШ\3(̀HHyDq{ c{GU4TӚ}i׎Lt};(H'Jz2N%CiIHRNX` izsջ$0TIC*. )4NվvCOe'2.+X^|+fzU׳RS VAyG›+1sjB{$LZJo\-FH xkх6*%NR=@$?$ׁX 8v w0ndMDƕkwȕUCmn-9//-\$ xk:R "3Aw6T,C[¢^p J\H2 yq,}i=>k2`P(G>yBf5ǁ#1'Kʍ>]XB0 !*#x+SNV/-6rzX "Dh' _U-X2\0⌆Vi'&-S[ogTu iNaN2aΥmJT]b8B{G*>B0r.m"++JJ ZލT8ҮErooG[vÜݨ6 AAʡ~iB %Q[d?X#2la)a[Hk8[]M$"k^qZV`~NFw1&3t0KT+dBn.))3~ NX]EYŋkwCcX!*G>P ޷& H²^_(>: V;m|oHsˇaJڍTz+#UŒoP=h%&Ny )?a_s*s:9WV1IR2>Hq>?X+R`&/as<k+? ! <: l.$k2]IXj F@ȃo֕T[ m8q.ML/+*F5V3U# TB`<#\DR!iJI[jH4* }S-m-%[|jYg&{SRڲ(VHl&ĝ8"+-6oh 7Al`, bR@㭫BoEm}[3l+!:Ŕ9Ҫ)e+Uݖ([͛4\/] RM34ZYRvnV #H}fkdhF %z2BuŧsdB '$0x kt"ҥD]׋[dB0pI/%0e&sځ/z͗yz.GhTu_Ds߆dXsy٧6 5AaU\d?f xt nKQD=@2cX&k(P@d w"dPPf47" /&Bb 0m ɫv-">ІE6ٷL˙ͳ&BxuI] È@#PmAgp1y9_%yeJZ@asF쫑e(E_ӉFhCANngqGBT"HG >~T-$h|*!>*Z"B Jy}5Uqvځ׏ ļ5<eZ$a)1`<(us~\(RAPrpxߨD$i@2jmp ]dѲ4CEAL/PYD'.("J B=(zT MpPRJT#H@E)qg-&# T"d l2[EZ6AA*>AhLirA \EP|cx=iB0+"r%qzT@!\x#J 2=1/Fw/ {s$FL=psTFCk qR 瘑#[rT] `T_F%)mW8J\yw- &04X4ε\$!dᛄVI=t[_k#2R2Tr yST~CmƷBBrIZ8\ MmK׾ EnUr~JIׄHW ͘RQdoU~jؼw%8+q)'VVtER}àvb OM~h4FW[KjJ`ԛjd^; t=فҩ.Dx fݥ!׋BPBR$Zݓ[`7%/g"#\b*^ ^aųe ̎\)I'#vbM\'A&ys4TY*RRI XR8֟躰W^*(< S?WtB~Ë%5 @#5 A;d4e ZVr- X#~Ucu[)nG A[M_6Sm: 0emGt/V?= O^Iۆ>صQGPl^5~)kĕn*D ͢ӌi 0L0RRT3he)-\&ѥ:ivguTA7,uǹ-d~f!]LrOcC)/f@q}_+wÂKNU;1:,ަapB\o["“cΨE;`H} CN赬Dʬio_!5Tf\jqDʻ56:)tbQ$1]ZZJ.a4Zװhnl8I+=\*4W(RIp@JZZl$6mR-95ln~"anP(,wl1$ םW#nhƨiIB i+oai+(J_)!GLɼjxՙeH*6ՙa,`JWe%]AVnI+Hf*"@^5wpՋVm\IqaA ŎRD\u3ɩ0m69jih[GJIOJC[aВ`*cCpx\u.R׷Pw/3O&lPYF\2ٔ_+p4, H5+D]&TǷmùJO=>UV|z]J/I)JJ:Z(M/NbH)QMj{?ȭ;e[idORCk@K}P Ӆu"cfË׏/hRQ 4u(rb,f3D2yHxbBmÞB:߱PR:jjB/iDδOv(|&9Erd_! ՙ}@$U^xWFI_y'q+yIk_@%m bqIZ^ i:Tj!IJIH(\kB6!J2f Ud)wqreƴcI*Er݄[ Q B>4_dU?aTMQZ,唛}t[q7X UW|!T>4)IyV$&Bǽ WlbAX A1cF)J+oKҒnY-g,}8CT'^Y)Jm Ҭ%N^[6 \ E,4]F7skL)Dfm$Gl8ŗzNcR p 謵~qKQĴòTA?e'5W7_; Yq.J)E XW;d8BRİ AGumN+E;)[@-+(xT[|#"S e':[Z+>f? 1O$n7KVE4UcM?k B)L!fu r5Tҷ} 3ٹP圭qquFv0)L%];ͶM687ԒU؎|B^g P%Yu*XZ#henB@%y !I^Wkt% F_,;z-X)Ij:kv} zA&$Z[,m!6BY21ix[I:嫢Qc(1/O.% chVW{)EVHxL7"@k6aV!EE%E%0@<+<K\\{- lIB$O)ask:=7 S _?ySQ;NJc? g(J̝ICkza0 YUy۔[O2ڧL6PIG 3jjۃD%ox$TrABxPYW=Ka.H @q*l +N>h\S$xyuH)Qw2÷VVso:NVbqhJÿB2 NVD;"O;8W6Uu5Sgܰ //(^l)d J&r6 3(Vꐔ& IyՐ\6QV9ƋITܐc{ߌsZM'{/]vU Ng7"uWRtHƲ7~'3[ħL4RW'qqj|@i+qKf ꮆEU_%`o9UfR`IL2J%#b 1vfR|ǙuKzޕbv~I{l ۋ}J%=Oر-YؙH1(#R8/S}:(@)gQfIԞu- ~Ȯh8_[J 0G_Íc-d;ωV#(PH&,fr'L\ 1݈i Sʐ"#ÝYJvNq6{5%L$i]H2\Ss]Lhݻ Slⶻl-YmPt<6XF+ܲ- w R"bO*6*ER$;*K'ʥ&tj. {PT]J)>*bKHʷdg2B&p3E=.12J*tII>S2jD{ ʗVf$wS0"x\u; JJ֩ H:چ<}Av -cZJ@t^Z}\VFn]:HO[,6$)zm:=fwv`@֔$?8Z fI5CcT !1˪8 @k&oipI>rO%$ &,8~։}HP+ldCe=T4XFM1.,G*E)9r!&btS7ׂ=W6@YI@M\8s聍i/bR0$|k^gQe0Vظ3 G25L(Ұ[lm%7)L'e͗'h-)PЉ f1dUmFӼ-&Bi1pAҭ7lGFivZ*(X)#z WQT2@ Ш[R N9OsRxu( tFΘ6>4PބI#OTLm2ǭDQj g-}썦qF5Sdp=`\Kqw#yVV,ĬI^ dzq~H{98K|[':,F M ~EV^2 ̍E;Ѱe%dX.Dr´cvIlDI#Ǐk8|HPjF , Jc7(Jp:c͸rt+fD{^T^͙es ڸF\Od@ }@*lM̃ƺ2?CTULe\N:8[e-1ҥPrLTiQj>4,$W}ț ZNHesnDQ$P$q‘k P\Wm)IG ,[L*xA4VbˋQq]F&Kgyx[QSD (wH:w5"<[V:,;N;t4{Np@!>'x/|V߅c)fP{e'Cor߇DO/}G=Mތ5)Q7^p{|1>ύN^<9MܢwP׉[TQ5׀ܢkcNocB3ʤ(FZ~ v#v5mVX`N_r˼.o}G:Lli6}WbaEp0dyD ױn8(`KS?5dm&{;lOћd7ۛe-roH-7Iz6#!HØx*OtjBiRn?B"_llRDCr)F>\ED@uMT^ o" eSJ@HR0MdGZЛu@ iА,:bii񌶄+E͉Rz7z[Y7H^ Be@$HvkOp!Xp#BWUn b6S]@9 >ms{<ՊN_{%3D0OkT!= l>} Ú䒕+“[{AIzp!0JD4RP/A0d6q 6]Ӂۗ[R<-}Q9A2Ws7!oS--! e\l ¬ƪزܸ%}I}dsҨ.CJl]C&˯*׉ӿJԛ@xd4;S c2y9X孶KO=ĵ|VTj ] ~)Tb'8H$̄G iRR[{/qp AkVeq!o*R9Tq`#$}'k9?4Y6~g P)d^/QD}?OMVYJʲ( M i]hc"(Lf ikQ$CN{W! (*a&>Zg5T%;ۂ{xܩ D @5_ Q6DbBS$ 44]cLbR s tVSu`;]*ߓ3 T6˭G"Q«Grhr*@<|Q7i'}(p389n'Bmz'C0oqy{p{?ĩ.8Iﴨ\Jɞ VM:EIV6òF )O9pcH"m v່Y Y)c&zV|"&"vz`j'Y߄$CyQa<~uq,B.gBIP!ļ!1#ҢY#@YA@(D[RA=liXmsN)h-+)G:4=BA(EDɴQ-*YtA(7)M"+b>!i066GbES4v|:'(. haDG0R;5v'c6+C-9I BI &ZX7$@ fRIN "  Lz>5ǟ&cELzU%VT<I@)+6oL@|.oCH0`tc7$MN|FXIofPD0/T-LbI$D+ԋ  RyDJNQ$1[; '֌e&*,uխI -`&cZ(&Wm0X;.ǐ~ule)Cl&+b r)I$IsvIY1X`&$[*ز' HȪS\?|I)ɓJE?0aQ[xյ!-}y9RDkγ3cOd\$@ctANԅ\a!a(51+TRcv%Q$C#)\ IǨb9gh|$J630åck*aN ʟ&\a:'oNPG:Q6q0(28(M^U9yA팣WhtV]~Eszge9E)nW.{$lS5`qkRYJh=JN:gN/ ,gPQVҰ/7._,iV0Zx5*_/XFE%cWoǻj*õ9c9AIn,W4C?%%Q.gP":Վ7&* ;i-RԐEQY%&ߡjtR0axpAU_+%v /dJBBne~,Ԩo;! !69$ Q?.E/  wI=5Bzg(@<ٔeZD)A@FdE[O aέ0Z e Y J\p6uP`ITiҎo½QND7" Uk+,cz"0ogBI7 ӌq2{K"-h0;B] 6UXci l#+*mhE>/̶@1X!YfSg@2Ŧ׍)/OB6 ň[ҳ4AsJBrfFpHC/(Rr2Г:EscJo!HZ$DnHK'@)Vs :hH:ʌy}FdVϥIh(b]LJ ҀAcM95Ejcu-$ΪZC]jAE{sdb^$.4WR#6 0ڔ_l4Ju~b\#zl #Ei$-!3 *qt6Af$BbU>@[uXwU!h@RH#Q|I<4Xm-hm%ۀRIQ=REӅQ*rԝXmmAΔL̙$WZmP$ _G吐AF4*p%"cEٕtvrDV’wYu8̰n5'Uncb%* )J>WR" V1`伀PVD £d.{vf!ԣRNg`1IʒYäDhoZtXbaa)Ĥ#&E@ eJFȖPTU,wN V,׀P=hm^FӽCs#R(P j|(Uu%[QcFFo 6Ü"r#2ϑ$:j`ޕ25${$XA]<+f)K0,ٸ=DhL]0fmij^ND qMt{x/3KXͳsck%ԟBB;(Y2R&m7r.z@ocb]sB2̕1fgF_a.ɛprռĶ4k;Fmfesf=~{6F!bR޿KRUĒl!@23&#K&׌08z֢ɨV@!*3[ZɓDC\8O0xM#/ElA{G&G(^3&mQ-Mo2&p:1-dkW?p8B UieL>f<-] 2٨nzB0[ʸ9 fuIaPNUT% GP}/D`e1ϭB UBq}:+ :H BTgAp@Ca"jP9 QB d@CRLk? 6GhfEDl5@$u*!&ĖX%E~zSSfQ D!*F!QA=˕Rm@J2X~4)oύ&vwΉ՛ڀDrQ #C@^THuG1hy!&0\c:QH:4DI '&/D3quB M^R9B iFf@D}sg"Ҁ@M"pN 7mP}z!T!"?:9"҅˙\T dxҘ1Prڡ#ƁQƉ:|Jdr)V(D@DUDQJYHu 1PjOmuOSPaJ [Ph2AN7}O|IAuOZ A9 M.`(qd/Nu2ݲDZd!MJ5J尦!e.Q|ItLhVB䄳m+{,u'NZYºgtW[7o.ars~S-EN1:xP#-ʈ.Ok:JcVG,U_@NcBMüق`#|1$Ă6xp5i)g7U_%EH2@ЏƪGQh'2UGo9.#VlGB5{3a3OߑsнEUU3dz~~9Tʤqcl(;H褛qT[V-^p(㓭4}Ttɶ8asUrdyx"2_ N(34j]ȶF߈UsdTk;%806oZS#\zƜ>-n%9Д2N_κ/B*yYxGx󬱏x\{aI%DS073U˽/V'vgu 2tm pig[ldL}+qYK &Rx޺KќovOJp*%6dcp[16O4JR3OOۅ:nIA!{B=]tV>|"pج:Hyʘ,\v]%T[aM\)9TU/-=|b @D@ ,*[ŒT*fS)>6Ka\.#B˽GjCju5.v~hj;&VR%Pe=-qzSMuP&6øʜQGf`SnM ߺd} [%iE$%AG5(܋iV$_3~,>*RRR(-9k5wwwbꢩ6PHR $XrJOSZTJ%F׃Z 3$#"t1)KI]ƨ9JX$Nc<`7oՁ8J);馗ԉېYnS h7VL1i8-/6NsrvU@V# p[HQub_Á w:n,b6om`.9[a)~4%.g@[X_fP TD;uǨu4 F!hR@]gւoDj;VB6㒥")*PiV@f !Kx޿O#RK_:bZV?XR5:h4>q8 BŲ4 G:ZۏFCEba-6uKoل zS_WД?p8,#ie[.>Ȱ[ -R J aƠL2\[{;v$)*mɿҟ#y<~F9 J]-0" I6" ?K C[A BAbq&:g=;$ho8ԧ,Q':B;Ds0 "s'XW&ep{ Fd@*/´+[>/¨͝]ʔu2c*ꥱʘ]ti[5t w[n*5]&\lK9+q2eJMƖ]V-=xǻKE+D y*-*/- Έ}9Lʜ: U^g쇺E~'h ROO l*KB*?|7{ )(꫋ z=cNTU L9Z!Xjn$Γp8E[7Ul"To& .JEJ$ݜfeVI,^PA#YivZC%׻D II 6"EQkZkT6M9!:U:b-m"RBNi 9 DjzطvcZUyb"Rk3C ]'~5]нe&o>a8l.PRɲ)qiRo8tB\[YUC_3L$`T!=O^\{>VBI*ZR *Ɗ0(g)RbL &'p=kr&RraxyS]j[!;! i"x\䖶m!рr`-D,%0@|Ν=^nDeTr{'Na3U'QT{jBiy^(̛¬u*vdJs Nb.T'S'ƚ~)m N/o_|e\fn}fFz # 8HKUH~`YeAVa75Dk*T^̝@:I)_RkB1*DIKWs:H&&EnFgqH9C*c {@}"êE7+}u[.aaJ[+OfE*x< L{}C lN;%Iん6FcJDԲl<dI+J~UˍU~cm-ʣ/8y @{}51bWWyXLN=zpXh^S*xiLp[5xeBJ@zڗR[Q{7`l \: "E~:βj{q]T~Ὰ> :qkr󦢦׈&:Yl MJ iq:#ض/Yߕa: ƱzwmݸT$ =>5ШOSBbGN2-5h ?hmkYH *ΥBʴ cf[8e9h"Ro׏?K{ڨv/P=epzG*XV`~NmF`})$( ifT›qƶѝd9QBHM'v) (qȉ͔a3V4h̹~Kma02sdpN*[a⠧~rn5[ay}kdtqT \GƁ!Т D'ΘQդ9h*nS ""!Qցe5TiPduC4,P`G Ё$E^6APhT ȨCNR8ޡ)SP|SgAJDfx3@$ʠ445)h:uLT!/@H ${@L-0oPm~/B Y( B  y!qFE#1J1b؁ƘSvp`doD[:QP]ktFtۤ~,9o@$"c: '1PLUB %AǀA]{} 08P{p*✰j:W:*B`Qqjd: <~w ߗB}ʴtAAdzPV_S@b2m PiVMh9.@ie0@cODp_g\sHuA v@P1 @B qDt#(9)d Xkp>5F3N+M x i{}ͧf+l:]e*0!]uTHf!

GwZU$ rmĝܥ:Fu<^Z ~ ZT,1Aฬ4 C+Z=lD):j]}g/N91\kn8R8蟎j1ܛX@dUX.+f m՗&&'kwW`ӝ8%9qDOzCNPr´ƟȻ6~q ͛T߅S,pY%~7vTfdL#Mޤp:.1cԒ)<yl#/&P*8eR1nj\M w8+*G3'T֣4\w]&S0>BLF"v&+)A.JXl[J`S<>f5!AXxGQnd2"z,nͨzIE[46םrgЏ ΫNΐtIä>bB],ˆ!*?#A%V\C rzʾl׋k[@)-r~F4b@=Đ)ө:[XnV!1rY5Nv-ٶ%$>\4[Kk) IML\]ާ {R_ٿRqM  LHZ#/u)kk=ƷÜ6oxI.2ԆꂜFC Dh|fגڛQXԢ;`!./ognYKLM3>'zI0$ 퍒H{[Z-h^ݗ^ MA@QU):t/o*yq* gU{O!4)Zqiel;!Z>>tRt׮o{+w#}(g0MB*1OuoԈv'amCVS L ?=)WDoJʬK̀B: |i;uz m^@$R4)mM?aJqφ) xH9T>tNFpأqXl"Zu*g9'UNcʙs at{*2 }"l-2!"svJ+QYQ&",ftz4\DV mO,˪jeMU{/"l}B@x7 QDŽ~٤⅏.{m>`A\brJO۫8\8 CʖܜNeLzRA)-O!v#1yIŷ7"㈣~WҔR H5I&k4y/  Đ@qV[=WL0[s1Mi v;WAh r|+.QWsJ}Q@&EЋKp;l|*J@K @Jrk$vVSii/ATZLSwoV=s)m] h]Tʺ*•zra03(&u*+ Luw dҜT3(SJ@,ߜkZ*\[ZP's$}gqmrm}ӕkLd`y©˗W{y!,ڜP>*#sCs[D[3t<1x.u>:%%Kp[ye@0OU,1o6RӇ(-YDI ֙W;W@'[2&nr\aaFe5 $9G]YGme 9#)8VgoJ&5JƷŧ)6I ü䓳2թa6Q|iڄ ;6Kx5 HR{ &LF4Y'kRc4,C{$*BTL'S1'=Ug#J#7uB}‡sjzfTJ:1>`QCtPmŗq) YH2EG8VmՔ=}'fqyYoS/v{uNC Ŋ{PWJകwjJQJI"O«W~].mm 9D&r]CJKd(X?:niؒHfyJuB`sA>jP =J4 ʱv/њh¨7!mDr}JM10@"G*]!obT\iA@^:fv5nE!He`j&4#^/ْWp2EӉPG 3(e_m#tc?h<I)Y`K,' d8鸨/,l@y@ G9|"naPP$I}7f:HkfptdTx;/EX1q2X\G /@N=a 1 ^Ȇm"87k^2'~UILkT *天kjՏ!Jд&n>uhPv@bcA BH@03Η+x27ܲº4bOJIk4xh>ˑ&yp[˅f-:`8iP3ǍB J >t(( j$8Sƈ( މE(D*Dq9B PL4Q!,;.ucQq :H6l€O%a}yT!DA-Z #ZjvmEpQוB/J=咞5:iΈL"6=)B(Xw<*J "*tZ@*$QDSP"dhXX@ YJ8-#/'P#ڠ5(B"f Բ gPڞ#IERhp HޡD߇* 8U~8IGuܲ:څPw)oJJ ~4@qZ$SJ0րE"h0BJ~T-ƕM|2-5bDM G}ܠ4Pu4$*RhuPo+2uP) |h#@iҠl.FUO5!4,-c%DQ!Y u"Âրqf=BX5?ۥM`8U3ˇʀt쨘7E:^cB}Uj$:YApsֈ |N%J+ʌ9""JqM<a&ne8 Ac~$lN꒳"v[otYFV;ގƾ+" eO)9rs_I*4S4M)[7Џ |)9u'Q3 ~L d L)DR'=>fއ|l{cpje_Õr%ԌecSƩkN|sI<bĸ0@q!e8"ݍmc6CKp el r?ž*0Zv f2Uqg3ub&AK)@ j`|iaO؏k,:ۉJRIRGzt TJ%kܷ `H[ F%‡FU7\ ؇C -HTJJZVf(!jø(DT=2Vmͬ ߜGiPٻe&,Ië˙՘D J:Ȯua^&\ZJRbD\EPmlFؗT)&T-A&5r4baabՑT/w'cВگ`Ǹ1 ]MJ&H"vH Dݐ7BK SUkҹcGŹ=Ǖ(ev9 ]0 ((xV*WKS hTI\ꩯC;KkeJ%(*IebV$_Q=3 Gi>1(R'G'UXnP*lܨMg-F8vƫuTE8jVVgO:1$=m]E29h+pw<k.l.Yv5MrEyơqyAdu #*ItlKtp ~:t 2@ @ZO厜UV<Qb@3r| E<ʊ-@`a\;{t~j\ң7bkc#f+0qQ"Ia[K~TEHM57ݲARr|SYY-dz5X(@΀5N̨ކ-p "fj,OiʾGpڙC+U ׁXQn ۭ5[Zs2J@D:myԪMIU6NCmhH22h?f3dxE%"kmj; 26ݪ~I0$*w*u5?Ct@).!Ŭ7P"3ƁaJ͛Ȏ:b:H'X1A$X= ơqIv4XTHtE%9njHWD"΀FQNU6^:UXO H0V|$jϬP JAHy(PG 8O*JeF*eN5<ԋ/AЉ :‰)1ƈ+1M (.>G͘ P[fƘ4E:5%͈2|j"[y㆔("bˆqPNIʊ܃Xu%t,w9~z@yF4(m_@3jPc)*P )@@Bszdy`CaFjTN^,*i4@qQqÝp_i D0xژ[@RLP (bN䃘!@;":(KBd((Z*Q'A(PVt@"Ӆ/@7 0G+QƐRA5 PI`SQΈRr֢!HVYB-̙@c;,C9>17pGݕl<8~uFedF"36L/_r.!ْ IHZOb]㥁qt"W:!|OR]@A#-9|PRQ1cYb ?Jk`QPKÔT :vz.|Ju& (Bk@T =&4mS)LtT4"*Kj);M6KID!CaЅ;wT&XT4!d4/>;M_M =&y;-S(PiB6AA͇BF O40lFQ(aql sTB(>50 5Cje)jY(ŴqcJII#D+-ALp4Q/"(Q$S u$b)ьmw㩴rqkBa(@qE'ϲB#͈pC-GanqQGWp~ߨp˟IHl ljx .7)KRmn[$eub檔8Q8:6rbJWCj̔ 2-{pN~J\+;Gf4U"R +Vwk( @r@FU~+DzٮO$42TqbX6bʒA Ecv++)ړb@@G[\bU361xZg gH*z_۳ٸˀR ؋O. $i#Avd߈h=җ2zӀ;d v%H t:9UI^8^0S8ԛwt>v-iԿ*7mC 0$As*whX={in@8uh. G3U#6Wq!Wf L0"8;No}Վ&A H1݃Z$Ra*-FDճCǴRwCAID^yMEhVY6d co)!A+p5deTEpZҒJV AyQnxAZWyHCmb%M Tn00A&%@&D׀un8weB9Ss@֢)[gdࠑ@Qj`$aV!}e@IJ\2fGN=)uLa8[S§7J9 ֟LjbZ 8e\6y@ i#ɥt@{Kmwm IJe^mUeqDM1O1(*A!BD"X&,x.1zdH>S r%`؀rŦhjȪ셣ݱ#&e+S jjIj~)NJQ.$:(FӍ9dL7^pTRQX'Y$q)閖Tի3\A$Np $G j[ÌFR~-G}F5ɂ%l/ ݝ0X`ڤ)``t&IܾH+Sç"Ūƴb[|2t6/:sk*ub0:ּWVqM#"RP@3z&Tl,Ŀ^3@Gw(5ʱ-VʑyAPzSĸc2lr  H'Y-7* e-}\BDq( O}m$a)oZaڽJf7zMRƴJ!(ݬ/p])" \uF*'l8ZT A 5`>[4dFI<|kL6N^^. -]m!!J6CmmՖ n-;E*2%$%=jOðV񽚒KB2*=-6!n͉ZcF9ekKqg\RcBOoQ"b b 7[i$ k0y^*Tå&FVt+~ZuYY@m\xeTnbRۅ)!ScwIYe6ܹEѶ@>J@Ck1ҷF|\0*N~$ֲi=A !ifHr[lHkhS*Y8J¾Fa'+hATVZGi[Çj,8uu#kLw$-M OxyNjMwemLC H'0#9)f[T ٛܽY({2873áOV9#e;6RDXH'YxeD%HGy]I\Qjmo*%':jr9$XuLF4lpcxdq I:Hyrv\4XKtN Нe\je]MJm*":&uX}9%Fr뽡ZE#5V%X'إSZJnkok=ǀBM'\ס!(s$st1C W^zD:ʻɞ*Iǣ୽a9@RV Oxih[c⏹CAv*Cm3HNƱZ<+ve{ɈwVݥr f?Գ@=b pCG]"Xxf{Foi^Uf=lf#4+ ~ZUlr/ĂMoƜc0_ƵQ0YF+QIZ" V@9[*M>!|C+e"x.H3j'!J 0TG u΢R&,pMdm8\^&7F4O*FeKxFC=Z^^PΠzzE#4sᘰ2+֨, Zf,xT $L€Dgg@ j՘AƁM K` *q 5ƿBy,Ɣ ʘjP|h (APv 9HJ0.x~ I~Q+Gz/<4BVT!吝uA9xаn4H6 E@ޠNFA'SPZSPֈA”a[¢ 뙈fܨ6:7h q:TPgH6PzsA'@b!Ym~ $&. weu'b-`tu9RŽN3@ II&vISUKk\ilA̢'c5RiDVWb:E1 4)`""$LA4ڄ*R CA4y'-@6iDZ9AV?*QwA4BPDD3\haȚ b(kfW + -TA~+;@lc1Nt Gk!Pdj+`3"mvXrCxq^ 9r~/l唸I7zFN=@F ,\)H+xWA_s:لiůf=s&Eu~6p3b&!:OzO@oضGV3÷uhGZV֔?ffl=#cG e~h/B:Jg(&TT̝qiB-ąT UR{d:_asa$II$/ ʐ|Vd_PkjbS!H2r :*/ nv$[}VTqʓ4/`oSNGҕ 1u8ZՂljlB]FtBSʼnZN ]»eLOfTL\d" QM?POv3ؽ.%T) m:Zhzu4^줫d$3)BOMj J{ٍ+ýio+!\D^dV%%ד,x^֪Y+670:98d.t^f ]ZpxE0 &trOdf[$O7Jy ޺eFyö-DW2&-:\=4ǂ[9nU )Jff83П0,q<W)jg#U4wqiK`eʦJ6!+Kd},:\Od)˕’pr$@4|Ecv;$a*IDu\#{C7g1^=XeJt !6"IƄ#7dmPM0 J6t?LC8݀!!9p:GfY QtX);UN`?αB.mUTrW([V:p-@JDjG"͡b-O~ϲ {ܞ:iZMCԤw-bP}ckVT5 Jm{-Z#h5LQqcÇQL .:5 JХh v/{M:[7/Z#G--3lAV[O֤e!D $uF7{|nQcۏv42*XTWK rdl*oo6YJR*I Q7f[* 3!J cϝY:ݾ:'Q|Vҵ_J uͱfjOPZ8^ 7?x=@WOa{Jɥg0T)Fu%J<+^Mhoy_LHׄ8祠MZ2sJ\L10E)pcj *BIoLy{DGQpo\^'c0pa *)6 H/F{>8e{P!?udU*,6NR8uᡪa:y uLyNERcH $"5u+,-bόRNTI& 4jQ[`'d{Q*T*!ZY[F4X8ի" YZ~68y@̣c14yK@$e`ҁmN:B+dNDS-K331"RoZ <9O+b : Sj5)*<BhT[A6B+O)^&?J 1Zӈp#+hձ;6Lro+ 6aå]]|kxn8~Zy|bNȇ$%BJ=pd3&UDlUOK-Fi W\%3^.4E+2`Ґ)+q: [ N$uIͬt{AR[_âw 9;Bw$y'x>BoQCdM ~t;aoW{ѿ{|Tޣ|§;+9_ ;#|RÃ8wIJ?Z7W§ޖG|!̤HH;'xW|:Q9;ӃS$Z?*=;I߁?ٓkBJǹ;ç}Q:#ܑhwg}>ȏSD_߇JEtHN#Y+%p7ו@t5S,Ei}NvD0" /P# <۟ e"߅fIִb^QK"Mkc򯃗.~ d&vص)9VH<`toqtɄ8xo)O M!³ַ_2/ٸ0 +}xߍ$\ [udW_Nt'--bIA>j]Gw S);CeJŲ$NӟG½_Щe}K*"HARM U(\$*v m8)uj?Ys/Z;` l31x wo+ŮQ OhGY;v6W!^aUR䏆,1|` V">rl ӿ7-p1;ArnnZZզ3^ mCd< JL[H nm5Zkk1*X Jvnr10k)^ŦLCLAl'NH;HNU}~ 踔)II3P>ulSTc!#ոA024ܽ =& a1)EGUݽKׁ3nԭhK̯=~UOۆUZ}.K(JÙ)%)q% %DgpH߆ԍ'U:M4V eckũbL(շ\OБ{i,T[l,^L.]w (5D׊^ől[P׷6?䀏Rzt TH[S)^tya}6pbR ' 95:P$}JG69NJILru%[Bq{ JJE%9TP˄*mSFR,l>Cc?bBߛI$̏*G'[c$% <ÆT4֪^C=w$r\:hgЗxx:Mlhy˘Pl +%ث۸0(f'Lka=:UQx˥y~i#MjI!vkve JDA/NU +WࣔH>M{"k+PBy!"%G*qeEm&dq Ʋ$dQl\v7h`T]~ b aC՛&Kpᨳ{=ceXgCB<Ce`km-k>+_@37<'ZQS`*͖]3Ac}ru灓7+mڛ{ոSϺ?z &El3;=$!.8I~r±d4@8L ',?\XQ 2&!סd}qrnt"(-i MAӭu;2Ly^Q߀V&A^i$Y{AJpHZi12jLjQEή鑜؍oʷM?(yZ܅.Բ5"ZyNS~TJme_$ʬI*AfsI-<QӤڋփ 䳔4ew$\;*]@yƺQ ҁrM+:(kxu 7tP Рo9PRxM lbj"/J'Oˍ1ƒ}'97=&pahPIv*d9y3m@¡'Բ鄅Zxʈ $f2(m`uAE2g0edCp(18Ԣ.P ^X>Hz^U3yA4m9pΞEry|YxI]sn&"OV?V#:IX)"S33U>i`B\ftQ-@ 6R(9QR?!1$r*#1M37!f69n.qTHYhc~d,zT;RG?!Uwm g>3oV)حQXDi6Sج^c+9H0yIdQe&Zu"g Cljê@6J3[؅ LG?:a$I#NJXkO-m ,8؎4# <{? a0 "F冉 >5.ʍ?#=EmPݏ Q)Id1[I'X#Shqaw)*{jVZ8è-QƟ,`efץc 1@#G( ZPu Ȝ玵F/L VYCD\Y"m]o¾dƳ2FAs l{UD2H75>_:c1j>Sd[M<ǝT\eBs%Bʼnˠ3I; KMu!*H Npz)dE:1%G0 aiε= } +N}*|82%H))HSN|n+/7] |*n>+`YZE ?M h;Q.Eޒ0n4Gm^۹:rɱ/p@#8R ݊6é­uN5dRBcwltvRJ RI 4 Y8: LKABԘB$)j>'SeIoKh#9H_ݞ*NT/q.ZE>\(1+@ȼ6R'&v 3SP $fԒlfb-JpNJVTLyGqZT:=Q[[Mǹ5. |j?Ȼw ޅ_ӤX.k*92 Rl<][b7zŀ-Vʈ9Uqi3O5Y`w RALr  W%r4&/kaø\ōtYd]4S9|?+IL(&+wtS>ބ4TQ,EbBkj%`7 ,RԔ(711Rco8\RFLġYBJTA6(x%+~q()!RrS'ҭ-JDY)|Ry.fpiR"ܻ XVw;,mjM(kJNiqJsH)"3›pok& iXp_m)Wf 3˅iRhӋ%B*IiX">m#+teu$\rI6Ը$-I-kwͲx^b.t4eIjc{Kn)Mv<+RA{Onh<ٌ#m/ Nib[K|鲙؅ 4{1-JbM% qNBP'hKs@ ˲Bd.G/履eӶs9 )ka0_W aE+/1{I8gKV I'ҩ[AǶV3ʖe,Zw-^~9 ژar: ~>7Pg٦W=eR/՗sj}̥"fI9Rm:hCS#tg%im \D6Yjm1ĸdں8UE|r=0ƶW-t&# e-=$z8ˠTKLKv9E+;--SD:ĘG_xU/-L`Wy)"]KWcl1{geCQɵMmJe{Mʠ8%S14-dɫtHLm83ƨ{ 10t`@B3҇vUxvӣ *9e '^Y<k^){TY VJ¢@d"tDnP"J% G 0?b cƖtID##ʈ B Z玵59Ni81O P'~4(LT wCj\yT L* < kT -Pum(XN!(Zҽ2 h̦)#( pֳE Z4QMҹ,ވo1hiF bW, h(Y GS$xT]h 萒̒z3<@?ͯvcihB9͌53K b1yD 1Y VP(Dns)K g2s2<Mķ4mOz p522ֵ+(ZҖ;3&+_l6z:q$s'6k҆&B8ʢ;w6`G&oR*]E*rG#jгjJ]FLGI mH$^:!}oE )"TQp/RIXP 6*䪨5;9 Q<Q9kt)aH`-<$0P[d>-Wqpz\ҼpMAw76ԉe5=_l 6H6Zu+.Hi.JJps:ixֶAxQ\DJ?ϖmA*Rl͌R7c‘p h)o$r<8T^%-ۿE+ f[M<`uߦb ?"^*{JSa Fu9:Osq, S%$ u_at+ټ!{^U+]x4GtRmfQ!V B5IȭƷEm!&J &m,jcJV0VgT%r9?sWޯ ueu[z;qA*O`h){=X3 2%1۟Cr܁F*$M9B%~T)@OZt/Z]5"F[L ܝARH6Z͞z#_[4f.zTz;HCJMyuy2V譋LFa*[e$_QyI,82N-s8rI!3Mp*Wxz)KP~ k\G>~,6 'gRb~5L^K҅{=x+ ? = |Zj}C?7f{/ lEgT$dK sL6<F0qVGV+R߅@9eJ{k'(ɐ.3ZJ+ѹ RR" ΝfzE0Kpbcɒ?y|aE$ACi*I nȈH/be_d l( iYHāngav@97{"ױ ?~{۶áL.Iid7IW[ߨķlZ]\iI#qFJ=S@="&7CK-R$H,F*@+v.E;C3?lIlbYZ9VQ Wz߀ȤvRT*Ԡ1 ~={.^5h!XÉngS9/M٧Uh̛k/m} qobVE32 Jz5F{"ʖ-}+ἍҶefP,dj{X~hH$p(i]kL/H;_,k@Ɨ[Fl Bo!KM] \!>$qoOw萌)'!i"GfOM$!Y8_ & +ʤ-q7ѻ'kDgdT EUD4M*x±4D2SaL$eeȝ{ld 6Uoyi$2ۜs5?nAUu]m0h[C@0<7:AcCA"8JrjiOvBCtQDn')ɠq8wSP<>Q}(0`lm>t:yxҠe=s>yH P"ZPj:I<*M(JfLx  ҃܃QsJ  oޡ-ylցNj$Hm(gqy6#>4@IP=ԑ]{g A#tֹӓ5EQ)x!¡jfG"nrk "`QXfHL(G13022'NDV.DUn*|YzGq;eH9ֳ3l發RF])2zLVP==ŹO1¡ lgBBOEW} oh<킝up M3ҹ隤Y2H%$pֺZ2qqjKoۥ"5u4n-OZv;1PQ$h$I_ VS(8L RU*c${{;`1M#ݞ88V7x/IAnIXwP({A&&dZR*@s18[)G_t̂ARBB=6\l5v\_RRT%v6kEY{h8| M|+R(l(odi+eGR<)5.M.l#{#[Mòr@ƹ\iFPXRfc4LˤwǠ~S#g$ƻIQeTP4"b@㨣ȭiP=iGG[I^G}rPHUy+-Q}!*C BLO'H'~݃!/o3Jd0IB8 qZ%XZZ/A#P/ly=+R6 1j8Bt>$Cx]‘YRLڱuoж{U{?ex0IZNSVt/3E_@F?3'*xkRdh~*uONƽ [/ÜRrH[+)8l+E%L4A,X?ftn^[ n>5c"B jחcE>BB 8qXݭ ͬ18Jdw/0EkVHL^nJBސAxU+#E6FMQW xG1OZXVJ;3ٶ q%"O_QF}jK]*=2 8ɓke(S牄?W>GhcR~ګ=N:k֑JK2wl^ ;c2[Kf쳠 #h˩#i tG>ugb~ p( ZoVGx\"R ݚ8})侩Sm"TR*irupl:[hp5^(IJRJke7 WD8$]\3*e+"O)&moJ!`POfSVeN"J@y/R8Gǹ̩444"j5w -O? 9{mOaWQK(UiM2h%edKe(5kwi'hurjlR 2cƒ+ 5H S2֡%!6;ľl}%ťdFblGCI\twcl%ZBݵOx,r&n엚KIɔ%$A]|E<"!}|+Ho Մ)%08AԟHbrv \;uJI ,r"^rϺT.˪2fY*x$wu4qoZE8Ue2J-i5UVcʂd-%%@QZO+*/RY$ك~ST׸-?a&aí<@3wM;.@(%N{t$P QL=@eȭ? . up5Q>=e('4gYڝ_]#Q;UM>Xʊ 1.alVA8yU1,aQX RR: 8&]H(9Nu;C)$'PIǤZ~j`1jŷԕ 4RJLwa t>dO~]|Y5/lA#/ZJ+sI|(} xs%余pYSh*J 7z(٥/fvD)@J #+t|͸S!EIʯʴcW>r|00hPNLzSC[S&n:}52vlEK vh\6G< *Њr;lI&7MD1Lp?v@7}1^&yk(8EB2hɬy 0 pa!Yr#tISj9I:%<2#_*wISMbL߁ƺdLy`oQ'0[n3P·^5~oځdk˭7f.f%Ԭ؋ζ#cXaRO\,΄x'FT9)#=! jBӤP%yA@%sx,2wG pDZo\D1F]:&!2mD7ZD@vB YiNANP(TC2t1PΣ-M0քGƁQΡx!fS@R`ki֋!\PА_wvS~u/.P' FlgDž @ 4>D 8 4)h Hf*':Ts 'F>] <ۄ\!I@($6HL:!ଂcBkzơׇ%ہ*HO:@)qP#X9* @=Qe-ĨAUOP\a#> 2;#@uDwFCiփ ʱ&&q@p8 \$tSDйZߍ7(6B>9<mE&E|"-aM*Oiq& 2y57" |hg‚ hBF B ׁA h*Iyj"u-QSB8IZ$8vN fH]`G19JL8Lu=K'亦ĩ@INzy4|N)9 r+΂<#Ɣb*]€ kER8?)-`(>b(\;l_Zt9S; a҇H&&c˥;\cSrodrؕ+5>t[Aմ S7}Eh{;Ҵ:3f$Cf˒EaOl BR)'/ V-8п>~4زd=7of *UI֦ic)ZRN—Rn"} ҬxPu{;;zjIE'[UxgC6V]ZV脂 x[_*RzH 0*njϦ4Ÿ*OrG`  I ƺVZd+f` 7P&+U"fo(X& VbzDl)Q9P$|L,>S ֭[ĭÔC|% .9ThRې- %"2%2{֢)U8&T$ \S'Dfe w~v~2~c]ؠ%=O;ʹ~wAv냭i AxGdYՈ9[TNoy1xʄg+3w0d(ho"dۓ۱ӂhIRu dS$=Ux\j*^r'ָcШS) I2?IP U Q-5j+\5jW_ѸPKT5 wtnVw莨-=u1'ʤKqt-ֽFF=`':ׁÉ{_AJ>MH)JyPA!<`mȡuB .2xEH,IIb8]J*yJB I"@jI5\5:m?`(m2, )<\N/sU&J0Ty|jX{b/-Hi;6Ў= +n:gS@|'+hP!6Ȥ&hO9 Mj)Jsi85 ֲ~~Kҷi{SqcPbzՑ^-EըdܓzK^gTL 7B(fp-?Ʉ zfY~ srҼOT )k'(MouSj}N% 8y>Zڷ"R>7sʐA'@jHYSrM}ca/bW,nrƢ^c6~WNM͌%G+:u3ݷnNx౯f'l P OXdm.KJ 1F𾖙KwP%$&g!"Y%[;eÙ #*<kF̺)r cюŜ(8dy1 j5.=[WX ^D nl~]L5۸ -*Aqp4pݦv$j OtZ"|QSUXEyM @1:ʱer88opjI2;W5M@J8<83rs2e%bݻ EbH16EꔪO%6)A*I'u0~Cʙ9ouA헁셷 9ANeoʶ6} w[FڭtvGt#rMIO*I85&UV^s.Brb֩#+5 v5}J9S47NÐ%(s*U1r3MiB0%L2&trm9}t%?*q)uQt/QƱxb.+U)JGhP5m$,xyViReky0 H*OBjbqe; bP3 ǀOurKBF~(ٌL% lt5_Bi~\[Ɠ6˨ N7J:z6i w 4 jH3)'HV;}o]mb +Bh.H8q.XԥwxEa~uD_Ben}p6 ̥`M[ WC%`U$ ڥ_<A #'fI I7j UV=FP= I"ƂuܥЮ1x|jؠ*¬txȱc+NAldJxI°zBu(,nxY(_[q4IYՋvSZ(V'S➆ FI"ڽ7hi֤lnaFh[GJYueD'QV ~oRpQnqg/d8 > nbTk$&}Ȍ懰HSMD+?36G?H=JAjcB[H3 p{zk^3<*Rq`+ZR*6乓 ~TpcɦS̫*) k)qlVE$GXkaN_GWx?I[.dWOy_ɓ"y1rЇ"U~)LvQ5t.5EϬG{ii/y@*No +jٕrl¶@7k<" +9hm?LΘKSq@=uH0@Jln(u3#CY"8=|-B@jy;EyHX,#3‰г(6SC3q0m&(q>Fc$PJŢz!1%$ &Dwa 4:rZ)=X`A-L4~T1&zt1!*sDN{;4ER8T ;*fLޖyÕ&O)  k@"7R\|jP"r-DRchMozfAo hIH!Wz>@69ooDHpwD[]Mab-̞t)ng7B pfZ4)왽@KyΫm(uÔ[H#H*@ T  Q ACD3&9Q"('B5L {>kxQϛw)#*O^#EޣW-y?> m%B ܌q7f/c ܮi$#(+VdDO.knQZJ{l ΩGCJU1ҸL5hbN+gDT.I 1+!'Veٛ9`:޲#]Rc> j,/Is`/ x Xue&9D# q9ΣhT uјm5>`g~?*9}MkfaCn8ũ\ t޹s|~PGt1]9A23}4#pE1~ kW`S7l̍+$/r!`[ E\:]-O/G1 f!9אB|foB`lR +VO$sC '{)I7Q`p-^7ེr:hؤle.I:1GNtDK#`0bVDޕ-n~ZCu}ٺ|_@eQ6I T ZGy~4o\"q*=;7pxcHh<GS Ҥ[%v$ j씁e'&edqjChAə]ϼ@ >\[䏱62Wn%C2aJTGTzi%*K @Wb[f(JUM8ДR_oc'۽ %$Ot,OqW.QϱTL-͟|^q޽+KJT)BV%XTi sE\k~b1 R A s tWZ.7Ob?7}U}#5e?kmT[[l\4$+.w˨k KCRIJBTdQ>tg8VE a cochjZeqgh b Y%G\ ܕqE٭l=C < $ZBY[)B@# `3~Jb/o>tJXʒ}SZnN)aJ%r{OܒUТ+z 1nFyW?:z|yXSflbJԡbl bUsX#1] \ƪG4ƌVÌb# ubүd^dISam,"uT=@`fW*VLWʶvxzNGJ+t2~ƾxV@I(($nZqujgBꉏ(d/q!-Kn, |+dc[-ۤW#R&I} '/Jч*.r*~B>K;DžDCT!./@TJ"N,Oj[%l% %s5rY8(pJB= L]щ%#t$8I0G1TH+*v=^`w)O/ K:,9Jin t)%VkZ*B0.9(ʄ.u%ub+~$ͯ|S܋$7B֑9eH>Uvytƕm;bjCG0Wp%ƺBNɻf^PgTV& &QaוiÕeu>15M-o%5*6r`)BVĒ Bݱk}r8U)XTNdcҎYtVlw;!I;쫼˖h'҃zhSsŠ2v^"uORُ;c1 HC) t$Vz^r^IKdR5CK{Y`{^cjXBӟ) /4&zs+1qmm OHOZNѦK`Sv1Y d" k(HOŽ{I\+"ڼ`88_ %H]Ք۝a_}KߔަŸfhX|>C@":>UȟWHP& %{(RLN@~7٠ƃǝjS0'j3'@Ah3ezf_NM0 kc $nKYxB$Й7N8r/u&sv3&f^AŌ)BfD:i[L㎡R`  &|i:A%"c˭a] ū=t/z~˺ v b?Jfk7fgN.+7j^թd&'=( /DHvy74JB"ÙDVH+ pÚ~(4$9}*zsaN8_Z<#K@L [ypց:!zT!z4&]:T!Bʏž|{҉P іM l cPHa5t&HA(jM9P 6sA7ŃP$UNҌB`J?s#AuS s%Xe= /* Ɖ< P аAsـ/@pq֠8kCހD3yׁDh aBM!959_J:{yPEDBw7DRcz8DFCAe*LI "R ~ThCDBKb hy$ 3&~4@%) O?ҁVƠN)*PﴤiCd_(ڈ4@*!{k@rLha)1L!Qt2 @g:7Ә]OŒ3Dg#ވ3UF4oI"~b/1|2ţ'Õv}w~TVpo9Θi<6).g],5<¸&u`4n &m: *NR:`L_Wʞ%0&:>z;۸-%ACұjT\2o/ҚJfrǎR H [D `UP a%YH fij{`BD1{kjt코#EؙkL-ޒ$xiP,B04*e%8X6cF전%cl'pH>#Bo1Ή$\u3YP<#L $I?ڼhI]: {[tنS*V[biaŔ.RTW=%՚b;⍒t4YҺ-fYa&TP\P+&uqy2OEF)ԇ EU#ʟIՓKj?v,$'D㮵/[ղUq 0!%@X -R,KK#k7 IP 5:e[ԋZkn (왃uRFHrpi臻Rp0)%#)gXЁgB QJqJ/ ®}ߡRHinR%F pf*Ro" wtg,.u8JGQ&k?i{$[n613RR>&m3YEfͅe,TVrqVO̫8,`(Ňst&N56{\ ]4{vmaSȘO많:bOvlmJZT:Jz:dJѦbٜjD0-: r?_}cp9A0 +:KuC.9ڄVklS?Q.gtxZW*(Y"b? ݚ=4`$S-Q9 #2R"j _R;V !p AK TMR |jeSQG6g(D+CA聳2 )a&T}jjOEՍ)&UI^C?XҚ$ͳEΎ2V3$ (hcQ$%Ra.]lT0A͔M!;AS뒟pE)QaU7\[3Vᒯ+T+'j$ykRȐq7:Z~CTX`w<5C,Rh2}ڀtA"$TƘHǴ3d_!;Wd"`wa.8@)3ƭx!5oj(RW7{bg*ǔWݧ&{)B^ QRRe dzdE7|($eq*eQp)O^?MRg`++Z`R? 2iF V^#NI?:5MdQ/(U/7,9<^N-4WK%h6?ɠIZ=Mei~4Fp6d82D7RiQ0" D?TCHN#F!v J*TO#eeܗP |(eodGj bu 'Et7 mƶp P'f@8MW?t4a#{JliV{ݓAnFI/~Fm*TLXrcQ4!vO{W*4'Hsjv)dw zآCvDJ1['i) M ru^Udy)U.[*WK;Ja#W|=jX\9PwR#|s/p1ӥBFYsJ *xAW/V!m+{O*ʾtgu^rt3*j?vl vG $tf;bSRo9IZS;MeV1ۡD2훀f _R簦ԬImn%=DB˲Q,Rf>W4lZdi zDUSR\u;n{daY{LhKEIFڊҾ uASoө[Er vkim};C~^7p[ns ݠOhac$ΑNtoW<.X*ebwr-e ZSd ʭxMغe7i! kA&X1\kо["x+nۭԲ\TepPkD2:VV㽖/o:[ 81'*'禕ZoQzi[9t#Ip*ajګ[ 0JRt+zII)肌f#) "r6]TX ,bG ;E;>!լH.5K[߅_Q=?EHaRz3idRTp:``}Sss֨nOd mmHe-!CPVHהdָN/̩;ssdVDҌ{'\;x[bޤuO-Tϳ,1[ (XCo)WEQJdVB!ĺȅNYjw~DťS/Kdʄ2 3R\ZҘic8 `ejcq.VhNSۨ==1 [u-Df " δE;کuJaYs. q@8E&$‘۹:*C'@* a [l)JRQq^n ?ʒGq ߩ\%{Bc ^x 6^5d9V#p,'R+ [^n`6>7J^REFSWG{$mhg@ğJ *nRbD0uVbnV^NtbR`ά͓DD53[B! @ W35J HcFJ\ ; Ϻ zmGЪ bmX~ NHIOg[| O2AXBF=k>=['[;#*@-H5+M*O<89Uܷ7yEN8k 6ִ%+S>s.5!M >5/Xexf`b2Amj3HHX!aIʴ (j9x6e}'[nh[HSk y9lUWB?AF>qMۓ. nx.ņb;ւ.tt!U:!kJͷN0MI+HZ*36&*\IK-*M &/u\l[YF[9[eŊ$EcT^J܌zS @J}K 2qWT2C/{MDZ43[4mq\]0C7TNQT#3zW)Rkq};Gi*YBFe.Z؎TA^wi,+C G,uruWp`aB7|(ZQK f1*IԞԫ ':$AG BNF ڋvƚkhˍ[$$|igP g ) x=k%Ӡl(=)ҁ:mϝaҽ?"p͆x"O'Z 3J'3gU{HAS%'jcq'n\X+ m8TAJFT"Zp4EYsƷEQ`IWd"ON}+~+`6]e9<{% fARtk^WOmT\a6w*8 Ӡ?̞cbiZCqP>1R gj^2$cCZp(qdv *l?65M.<~_}^)^gOtȲz{A f[V2H7IJ;6}yP&5#&m>U IXyPB*H1&j(NDudZG{f'GtJG%jwvg71(=I!"͖'ΛDБ'_gYZYe~wp{% uDYe~PPUE2H*Ð)X2WqhFBmLʚ돒{i‚ V&]JDBL35SnA)̍`8"?Q^{H!.Lt4."/ \:͛t͆liĊ3 $IA`1DxIAh>H-! /(J$q(FK&9Tl48Vtȏ $F4L&iv@;QAI: J!So sJ c̪nƉ;b>)C'¡3-րE@Ɯb3@\I-O1@"!IP IQ)6HM@ <!)|@i7(^SD C($MLJ8mO yT j@#s'SPp/Ρ4AAրnLDWD"D; u@%@@'*3P#aAF_$V| k5y 9pm6.2dAfxDJCQ ʓ$Ƴ@VajH#H(^Y? 6RtZ:q4,86oz<>ؤzkYiET(qӗV!NJ Ϊy$.԰ԣIUK/C +[3R^ #) !GMORk&IP5;} u uL;i+J00aWR"uMr_5IzPzOγc۬ҕ{&~7Qal!4:?EP%)08ԗ&YSI/s[ 1=s"<+6DȾ4 n>W1k."-pbq%L/|m."r|/X{lp-Ok1+{iKfJq[8T#@ q6V)ZL\#Ai\ݲC@cGg$ϼxOP}0M¨+3ˉк{ Xh"[2Ź_TcNf=U%so3Tr7ҶKʓԥKNŦ%6 ̬yxMS. ~03kvYIJP2:h>UL%4(o>+P\Y*@I[<.>,769nәJAKd e >Snf育ciBQp,ædO3Y7,C)pmk"E {*o,96b6!(H||Kv{tۃdZb閞p QΔ:W97/h/íI K9r2J$%{b+CX̀-I7 c.+/hp6̒`T&,'Ƅ68qJ`4R -A?CJDX-t9J$ 2"q 3XVJX T(wNi:E4E** v7JR;ݢ5$&=qU<;rYNp%9x O5LA76–/H Q(}|j$o z(A \l1S>ME9[ľ}ԁ2O- 㠬%.Kgw C TTRAWAGbN9L85B?6(,L؂@)#۸%ԏ®g+G^)ߖ1D]~J3K][ـ(A6$yS¹Q=v+fllSZΧp)[j$Cҟ\ÎNb $txoAe# *1Dwʎ*oaf[o@\)e$^#ؾhZ_` ts³2! 1&a1ޱF`l̩%iLuff+hPh%jJT qn5sl ܜcxPqYֲBQ-`ύTߒʽ{lhP*Cf: +rD I¿_bc̕`U!)OYűev`7AzǔHY@c&RV!@*;+~lF*G؂ )yzD:@pxB tDT!ի1tAiJ$;5ZLI43$gN4B%M6΂!o2:䒣ڨɱ?*9^")Tq֪0sМ"}Mل,>bܜ#7~JW$lV8e:ДXW$7/hR0J*&:lOZKdtV"ei)X8iNa;}$؇Q-qJ]Q\3Т H]䷶Y?DN5^V5VƅEh"I)&SvH;۬&Ƶ6s0h6fO>UR\g|v_e`[6<ݲ`*?tYrv>c.RdZ &?א1 ֥4T6(u 'bf-Y6f5YgVV9Vҷ3:r7c%[W9|tV$aa8)TGJƀPf``iGmL*"1xfHNڟ8A2rfޕۇ|r׹njl;0"Y7SdzXdⱤ( YLA&-aphZQ$A"{ZVh$Z{gKc*m )IUQC%)x\xUQ;DFv7yRVAQ~:Gw{ NH <>!Y@u[kU֘t 8!lrH'c^o%f7lmS 1 Uք,tHRƁ|,'Wk&u_9GXBv۩sd2eJP1u1:P*\cr웲[$Ӂ !yOr'W,zOpV`G"Lf♔ҫК»BAR[Ir G&@ƧV!xW !%$"Uk۩UdǜdBlVsp ³I({{-bm{Ŵ׏Y̼#.`S3xSoy;&70öd Iys:RovKt_?2~YqY{e%%@kfMg-m mYPRJUW U[aJS-d ĞBhQz&ؙ7d`QK : S,pJ .AcZ鵳3XgE[J1t}-A{6JII Iy~vL^_Ql fe+mVU(7a$\s Qt.R˸TdVR#aV5`6)VR.& {HДb l+qDaJC9)`q7An5 }8t0[p&;\I—(RBT&bGNTͻ|.޹hid2I#Ӭ[w U.wshH'ǝQ ;-xc!bh ^Uqeړ++DLR5vW])0Jb U'\.%IQJIH[Κu+{hRXm6Bĕ)ʟ$t.n gwĔVf{%w=ijb[ۆO /gZPʠty];7cz$ bm}ssOSCDnEߝQ!0eȞ2j1qf:Ą Ňu)'ӝ o6TCxeJ2|?Qnv%{9ߤ$6K*ݕ)*Т.{ȋ\fd\RA*'_u=QF)c_S‚).W6HR~|V̨/0 cSc4z[e%&atNQv]1A j'>gifItaIu3y`s$yօBh6;mˋL9$#̚p ^B^P1Z3@55QME}XX5pxUZp(: h^pU;XTe)27\wr3mƂٕcSN21N | sEKh) ps"u$e,yy9xKi+1 ʖ LufS#uݝ{#)TܪM[rJ"ݚ;<C]ZmGFjqҶ܇adٖ0w=j~&Kea /ʪPfR{L+^ &'C˂x6hR]*Wc&W8wr9+CkV+]J- `ӏe o srFѢ.fA5XcK+[Q@ @u4)iͧ(P,]?ڮQPAyRT KvAҢ+X-'(/tH9yMjSȻWh'^!mڽHliuWي08v >]n NJ;|l2b)X(-f&b kjoV*]K4=dqú Ex=~Pܡ[Lr:sec|!E *JI SyuAE$̻kEhnzTW+1G j}`aCQV7Q1Xp9m)\ DtZ,{8['^13NTo  H뚲Dg%ȷ|l+3~J]ءMbleˑ ӎ{eN<6cø L,(2u3j9#Y>Aq{O3e IL_Q򙩖q!-* 2ؐL9$H+G!);k O4QVcY7[2'B o'S1%LQ>R:ViE%-O>*ڙNd4xڋ6q(pJ D(k7f-YmIE%Oq*bITL@9VԫV);1X:rPCCTV4ʝ3u$,NPNE"r׭YM}S cWV̕g2J!i/cD IΣ J ׂTdd (5ܝA肄fVhGBعlfBuz~z@`U%ZA*s(Hj:`7#&3l@JkggQjD}VTa)>c6-&GV*5-7#ӕ`[Oh~S8'HVg/uqyW\hr< ZPi&L4|Fy3q*틉a1Jb[D ׈`!ߍi(Q 3tHK 6">$*Ð+Cy]+3.-RYPAQ1υcdSS,{B\<"V ΆxS/ / XH =+q3$F`H5H>r Xekڗ$oiÍp?dቜR2sZDd=5'N<"K-Ho"$aBZ(<9!IdDr΁1cP';5LR mЫOLA˄IGP{P,EmAjAu3E@yϣ"@ƙ!HZdL[herhJ%bdp=:M0U4I w)Q$ҡbғiAСPWTH{ͭK `$C&#d^* GgcHw0}iB*2ĞH?@hwL(tfX*INAm~$1}5Δ'S(} cFHH4H8+KG*xD8/B (Q4!)ơ(Ȋ @#mGKfcC'B /*cPf@^82F kpmu(NU:>@ym~|D!Y@t8 *iY[PiUy$҉4,K+p҉p(JQh52j I [/eΡ9@Đ)G*YʡjaI GPNli&/D(@{w9I>A/DׁAM{ /03Fl&.BO+tǍ1<fj 1ݼ[(} _v`[;3Ip;}FƩUHtX'ExROy2Ga$M/(ċ^u%nɗ5Teofݎn uqe$?d~_ %BebY>_*( _,WÔW. Rۍɑ]ypK{vq0'CYqKlSoGh }l_ װ't%ۤ<>īa=JlHMxG pӻ dL>齈LZnLʝHopxB Ngy^0OJ9+Ǐ[#0rBEJqrV3 "bNTha )aas'~ ܬ2Eko&Mh jkG8 E6S,T 7Tv- ̫pg˴uSjƀH|<ʪɎZPviZ4ALBV DS1K8 vE?c'nwcuϻ 彇uʞ}Mq噲1K TeDft_μB!Xa OƱ ..Ord9k#6͝|{iF5i) IkX%Kٗm mbGY\$SH[b A@S 1\8)q/ڭP ]E%">>u]}ǿxm#"h= q 7e$$]JTǎnR[%H;sa?<UZTalA0f,ṱOQKxT,BxyF+(EGnxUzrW}xC%пgi`6JpȸR;Zy]}x/Th!;r5$`9M\ƩnLotF70떐Dn$XW<|j}C !&\RDf[kjN+A3dc6V"V'f&TxOW,Ҿ(:9͎)ԅc1ӮD|KWpYv T%f}I:Szp.+Bu9!B2 G-+6y)E֝ #I_ dudM"|.j«qt_:TaZ-(pF[ruB{jcmmOf VD ? ↈ'n}٫m%Q!J PQލ:VYI;mjUd-XRf {z *ݩqN|C!)aNQ$4Z\%+- qP-#U9/QژR.#Ymcb?rpP#h`BuDYn@7i2kܪ)KlwI9ո*ȳg% u Wln+j1ԔcA«qcp>\-'ݙH=l u HoY9ʲA!6Ӛt*-ߩaaƔ$l roÝ] =+ 8:Ha)Rеgrk[=9Ä.4)(eS)PU}@|^(IRKJ+¥]ȒT)RWwog<&NAUPOG$[?BPOb&{_[hiTumc]ڀ-@!Ĩ3~ap0On2VQa x kL#_V͓ Jry]yS*K*lL6NjVgARV [(☁Xׇb+۪T΂xvke&6lL8RH$Qzv7]sgh)3qmfF;HoE)I E^ tMQ >Dt?YIHR]"Gx)9l] Ǡt!}ҁ&y溽cͻN@[kKpcQ4qO?t4a!MNUo14{/9@QOF[5-;aq" m_1Ӈw $U[BO2J^L+%+t *B: NgXT s5:(`)*38,N҄":OAǎ,-(ޛ@3@JPQˇ-ChN@25"J2MP#}iJ:P%" g4ң ҆sqD$YmҜJAOZ?6>Cm##Xp/vN Rd p Za)(Bs-z 'Z[bv(KP Me 3T̲+sYP12uָ:!`yǍTX PT@@a>ݎ@W -1X?t*T ޳]~ډfL\ {waˡ(%zH1kE2TWc+UɁMXPIv;hQQ9d܋y IɗB$:2N]8Ƭ%BM0slm6VZ!DʆT <YgC+#'g3Hoaan %P6I&oYwaӚc[3O esGƮY[3ˤ@l$K2JEJٓ3 ;V$snm@Y"W8 v͹ 8@pEQH5Jyl|k[/Gb3zYJh)oA#gTl'A|S5? 3ڬ2U>~Uj;f@#H,:k e`[Hމh $@$&nx#D 8@fL$>Uw_.uֶ[% 'P-\yKYC۪<2k3*^"C[u%IҥeU>anӛ]+JR4?hV̱=VgY[Htέ"ZBAMT[hM`{R=t'@9 yW9K}H)඄w+U[b/7c&6\uF U9V?aDpvذUs=C9 HзVótEN+g Si= ;jK[Ečmcgb6bO.*4kXXՈū6f/=MM'KP7*&mV)Y+)J"jCŠ⯒.T m46&I֚uxING}w6WFuI P Ğ K*7{{?BYICd}3J%U-N*V,%p9A0tM_orVrQʃX@VT#N23ߕ]Z$|f IGڀVxĞ|IjܼBˏ096 O"WJ%fp&mq+NR! A#«${| Ld^ * ,$*D5^GjOARE ̀&bԶ)6KmdB:G_/߻+Bqe0S\RA IuR.}"ȉ0I)I&<ʢ7d/nbPR(w%hy\`Bґwq[z+04pk'_ήo}^&SCE@I\7ċ6\=SyX{PkbOS_ŗBXFg@$6BWctu#:^a$@P`QY+IloijG2f)8(N@Qb/CNDI+(Jd-Ԓ _~SJROX ֞^]5 ӕV qG=d^ןTU3M npR 6/cY3 Fty0we*&l9@S ɴ~5ۯ6 JFCkZg|^Tr8}~] z DqS&mCsxםt3rm)79 O3:Q{ >&[yd:Z4ց0RDɏBҡSA4BKi!&:A\֍T 4LɑcQ 䬦qƁ:$D-4RH^*ul$zZ''B spCIy!?JWLiFNg)AD@AiwhuKEB(kxTƐ< $jR Q iQ )q`I@2VahDLq$8xy~PZjuE|=zT ⛛ <9ADQs6H}u)&_t֡”I-!V@"loE")yPiCXKQΜPfCII&DuĢ/mH-H1bTxՂ '1$h9BFFCI&fj"nBp$[Y?*92£}2|:UYx;a#6Q<b!Txɽv >|x Gg\l\Ė *VLf5z{Ѭ:d==xLDeQU,+)0@t/ieWʯT3T@O8][GWd7'v/!BsR1FB;0;o QQuf@UӧĎ̗m`[k"4n3z[E&pdPUׇ[ )  a:ƣ)K*2`Q:d*VT<'ƚIFWR ] &LoOmg6h O15|=u@[_Zh2f(-K&UfxrBqߣc *zS-@b6;iAvdBѻ uskVP3GeC*O \itb{ >y5&WƠQ$ @Q"iF%&dUZ~U$' -HYڟPWqŦF8OR:\p7X*.:ׅkjI)P;-@-C=UFYKY yǾ Z@ɺDu_Q#BNǓڻ(HN -֚KW<.Au7x{W Pt84ޠ*w$a] w񘂑N8Ɩ:7,'p`p()>LQOW@nqj2(TMSx{Τ|;}7[ŲA3H:<ۆ_ ZS2@aYTtܹ&niYO3M/izТژn%8v P%DXkuGOho[zv4Ég38>գ@Lq<9R /c/ӌCHD ^>e[!HR1I@:zgjQSҀ&" 1𬙶CԽ&U©HX8Φʨô'2f8u$qWU0 X*&ӬGyhΙc$`$ RtZi^Ð /Ur':5-R߄i$a,%NwdfjZAkuXif=)1f4rt(UoS4BV3`DڟM}@ݲ 챭YKYBOxdu11R5L,6w膗,5hRÉX^'ԪO-^FqnRB^}*Mύ1k^ ayMĎJ"5Vm=-i$e]6(: rB?B,q@9P@LX@~|ȩ;+%eҥxt<(JUVDKrXB%jd{cӅd%bBZl[ZQI&zղK҄O?u `6 :u#p_Fy1HB |ǎN{`rIݽV5 Z"A@&ɎFWe $)ҥdZ@KK "BG0AYS-|v}`9鞅0}kFN]-TY)P19diQ<2e6ie|KQ7K (p?S (u²D2W?9IYM[) yͲ7!ispN_V\RKJJOrښ2ߚ_S7)`-iJBA$#Ql虜S@[` QIH 򪜩Yt'MzN'AO'wT53W/fG 4QMufb'd@RQ I2ޒ.+m2*$06?!WF6?v#uq;Fv$!v}9VпZ_cq,MUrMdis;)\VBGl)%=C(T[J{"Gj;v:UXgMFbJU !.9) @Gu22ozk}UPd%bCr/\k֬b`0%-9\QQ;:%E$J#17=$\\8j2M⺐#6g.$&x ೤8.RT#CP&UGNVV~hgSCpMg^AJM!KMn2CA4g`!.F'osW( _wD/4{/PyLH63#nݖõL<Ό^¥Iΐa9E(DJ/9 /AoB[@RsӝRkRSA!ħ*x*T4d<˱?J:3q?$֡6<*2 (AdrŸk ‹ E`8T!Vz (: SIIIDJ #bYj&iXH8S*!d" Wrq4 s<\H*>t,& "fC#PA¡_ciP(ҡ<) !c| 0 (QOQdQ@@"ט{% fCqʘ]rʠ[Z!IlG(Č;ܭDA𢘃ENdE@NQӥ@ -CT SKi@$`T1j$Ɂ F6Q˧ 7!(=?:N[i4rΡj0MGpH vxPrAhΘEyҰ)#JqŸ|񴊖Aȓ%[G ԲvHҠ.8ݨ !8@B`*d)IJaG^THuG!>THtB9gÅBúiRHmбj 3.5(nA9B/ iB`Ұ)AIn."@ѢY[ ӅF]'QBCjGP'F.:Z:u/ޅ9Uݮ?*9͛W\U}~ƼA¬Xy-`7$ƻ&bH G.NH.-Ski T oLй5 i >UlcfL49v3W y SQ1J䭖Cmm4J r-`)|3pN4d흒6Ya0g&9ٍ(){PPMZxE菍sN;nE% )uGĺsZxحR rgM^1pJOpMOwCqț9J̺`IU0H<7[Sk^}͞l)JmI"fǗ*m:ĺ%a0 A[₂P L ]?y5# :GSljE/hՉ sYë1b'} wOYV' lI=ㄞCxZKvMV65[E8D)Fm8-]H*rv$uSuM,@rnDi<=k&xZ4thݠ0JV H$Lyڹ7Z0yCBMҤ>kZ/ج;p !PQr7gt}ȣ4每C?X-2Fo:q·h>[6kMKCRFnJ-SDWb}ʄ%5X:.w._hb\NwGUhYKtu,9pItZ2BV{2 iΩoA'S5 .$Qs8Q_a݆1+휄b CgY *B&+x̻?f%""9ljE:>z'hXÂDT3S49qGɆÑ&eq'@)xV|~A'/-[$`qS_ nvg q64) ө24 RqV%Ԥua)Ret[R/^%Џm7-+ u+"ff,QJv8vL~ڵ'^?*n|{ ~Q kRU(Q;%U!a!bNkf*#J%J$2 ZgW5D1vZ ( Ms.~ iEijKaBa)P%wӹ6 nzU{A2./fm_ODj0EYR776-+6%-bWlCwlܸZەmU"6hFw4#,QTBm(j3*ʊsJeĸ-I{Uب$2rY]KL]uv @Ѭq = _{-r ݠ0JY5 ]FO.[Ы W^ @SIHҜI?h$s5Rr4.oGfD{5I>qgq d0wJI S! G"VwagmF¸l}k w 6z_+سڪmU@ ej >c4x*ZzmȻ)a8L~S ePHH )dE\1ܬs&haKaAl< ZffV>f[EN;jUv^ K t$\Cmv22;At-*F3m iRO:~u ;ix0Ҁh"sCI%;VP`a~]G+d rYiI\WRzU$tߝJ%(*J"{}hm)eXm I&'6.^D(X[p\R;"iPz&:zNl]ۉb CJm2  iX[R+%-Ͳ[n4D$ޓT$IeGM6HތqHDi~YMHY%F>LɛW`vM؛5[AԶ$Ink![PAlM|>7rߩ[ wm4IB3=`U[{Ԩ:X*yҩj1!ۼۣi%i9$ ilO_YT:A=#/~"󿩥oC_fkCF rT΁D>"&I(xJ%\#0mw;V<@5D/Zkzj-'Ě3TBԅ= a$,$;?}0T`qQF>&]n1{^^COҷ:BH7ΔuyP#Dizv#~с=?d+M.E&`I޺6}2 AoL&gJ<bxߍPXF2PIAփ֕"'ҀeuވɔͦQP@ _f*i ^F,gIA k +5u@yp՜jK%61P(e/IoP#N%lhK/eA> @-#7T (0$#OˆJPjcJ_DBo ҒZRxB8)<O.F9xC2 B ɋ<kT i)PH/:`>u:QK؞Hʣ^: Lp +5s72q;O$aJi9vΈ&C95*]HqO@Aa@#@$4Hu$ҠPopA+40Lk@#֠A"A<*$=ӑQL!G4&N$A1PPH9:sHHYierWΚڠD;kP-iP\-xyT! {AҀNaМ83@9P$ӒTQ GB iG5FAU  AT!1*l>t@!J =u^^?*tҠDƈ"hK"ʁ%:tl\lHB1-( 'OxHTq#Ze8zѠNy.b&^{7Db8AJ3ꪃrkt]_fY!$޻sly8 *BA>Qnd|.M ~US,Aۃ2*1`@&$c{@b&(*n&tVf]@b8vs|c,-$DC,sҹR}yXv˸n]P=H@җ|/1j< %ސ3S4%QOYF=SˆDw3&\apw"9 TIEm@ -g+fFu)R;P$&]Ź 2W5/+ wf6į qTin*ºT2v9KxfE_a1HPP@"b< _jDNí3(2D*7-EX+WBsˀR"辣!aIaSh}jǯ +|˃ֆ80xp 4$X$:_֧'D;H0g myH/VD-̣" 3% ~$^펯+g8Q  "Gƫ/vk!)QV#%Ş ^ղ>'}#K嗪ܲ8`ɽT̥5Q$q-U+m;Q+vCkJQQ˝tc3nU%~r-W6V wv>rRHTbBo'±eJ{. PRI!A$ &jЗ,?ak+-rJc}4[lm6,v5%#:Q/XJGø72 RU*$@^q&`Iᥤ"'oiYBuv)L>X+D?Ү WDԋ|3ﳆ_JX'*LtxU.*7 \^Z0%Kĸ $+k®RRr+[_Q+,^ϣ @xI4{v& 6)(eI Z_'XҫbͶ+wvb6SAV ̢gϝWU܈L o.1L:+RtR-}4Zq[H^iQgh}!GO4튛e'C $@D`IִvwmW=nK I~5^|Va+iL3e=3U K-?0\SD2FSo#Z%Sv-hlxeK)BTtMs]9 8pT$H/z5?^ÛfRU$l3u]Q[*2c 839j- *Wr3 jդhro+v XV!.x%g&㹷Eڸ&HZ.(XH!'UlbaC3W!?{,͇h+NbVhwHr,~UkKh.5N)J]I$xzpU'`oK3`6˅*LIHFxܢ- S/l).KjZVlOBzDrVXcnq$4qJoC{86v3s Bɹ3Uƥa{`0!@_:rO?eϨ9ܦe%[c(H$hxrsWZw5[;8,A. ߋ(l'tEq\*`A+a ݅!&dPA:wܶP2B֞@:wiF5*]̲bT ~pވ*1+l*>p5ʸ7=DYZs eyTeM]Z [ N)K(P#z毊,r_qM}jA:JW% iTUWm-?XH3JU Ց#Kg0'!A:pM]ާ_+a4P9KNҫyE7t gU;e.h2 EI$@~R;enle%YUTVjaS;?~UY c S] H/N(Zhؽ$@-JI3:M=S * kfIeQnfn[5Y^w}DȔseRң[ JrY 27ӄUJClJoJɢIHvN yTUM+4JU('*XJI{ %P&BKl QR_ mi+  { ؅۸m&JT7_"Mhvsjd!dϕvc-I3T<FC=$ދβgKq+M*ʒB @z hڸ¨ VT}[0|+TU*{ ox$ItsVKʦa[ J*PI*2#)<4-!&kҹ󿩥h0{e]8~gZ Yd LjF- IҌFi}xS{[ECS \Ԣ3 \D%A^-}S Aj-'dC%*SXQ!@L8SKy;<8 $P*h?*+o9-}΍ҁ 4dȏ-RlA?1ݟ'7@rׅ12 NKj$j "%?*#'j8֢DHz \Mu$(L|h%VQ1В)Րtdmy:sƁ!x$HBqb"fQ;-PsP"м+I6 ODBg<$ %:*!1Qs$Dh^%3P^kt5q.oM(,B(@[EO:aF=?ZPԌ0qm$')\'Z)]?: GBEZkT8'IT |aԩ:D'R?D HE0OQ~^4u :!ф yT  ֍w0 @ J $p)#CyIc)бn5ǑD%=K&'uGvGD ۰7)]S 2~XKKG®\3^l<<+> Q"qŬ2zV|QҬy;t/jI8 ˩G "vKII.dc<+$o;9A硥=Jҍ1c$ww(;RDm52 9EiAAv굤t!lٝ{D&Ađ+ZA<joЭiRtiTԦ\𾿼Xq-T۫B0|+|/0/ZdĒH%(/ #R8ҹ~|}X;mmKL\3-\"/Za-BKSO#}%IM߻7~1Xu=@3o#fjd:ι&~#XmʺKt3j(qFe@22jTMDV+RLAJmK]p/Թsxx–$oYJ Rb1ӉPKdD,dNp6xbPA$+Ehz"6țrBV. DI<$|^9}{lI<;\Sˆ\ -seD~HHR] H#*Tc*e~bqV/i`^/x+BB+OI:FȳREcJ`x x-b[ q2)AD*p 9iiW{|0Iź?=m@e=9¸\ԫލ66V+DWp,]Ahs] % tۗB"vd^5sYsqĔa֯Z+('T$yUox 1{-C Ik"~HQ{5SQ_[' ٪,R8<gc#fָ A@xTycs ^2dOJoĶܩ>U)Px!T%:uւhYj*P4T6[wgB蔑bA}X.;Lw*$&%^|EDJN`^cR)-)VKdM?gQ7쵍k;$$$Mtr2-|:x18CM Auh- n_mE췃e%N,`XfU:iF?ĦvB6{,8W(fWUnZ[q_KjA/1REұ%;Xk+(i.T;=zN/^wLۻ4};56T4rAZ-V3[W*L ߝxJ ex\CgAȲVڣ}>mvN@!r$:ճX[䷂D)bSq'(_IVHq EֲA%ݑLᵃW@e{{Ï_o$OԎOD=KV]%l!PRK#$'C³.;_=ot;+h[G[8i^Ln 4dBY0YozYwdUlm1,Y)*o)>1x@$$DGj-?{$ :%m6FExӕ&O2kc ˉgqM,rqJ^-͛V)*m#0&U8)gR hu[.pJUkuCSjԌ)VZC2ӰdJbdc vꌵFy)qR O9ҸW&FKKm)E*VҬ>a\gP9H9U)HIo+NWH^nm6 0K6+ Saw_A!>Yn)7?Z&^Vf]"PmH JM%;wi=0ŵ%J}AlG J|rgQ_rj:6bæ$3SEuD2!'l7xD}‰lRAIE[|yJfDpL B083%&֞}m1r: ;`:Xհy+oЯ͛l)\3 n/eAU?vp\j6&nQ'l,㑺2Kd$^u0yൽ*j=LPׁPݍ? $ EDƀGsDe9٘il"5,iΑBC$ x ӘNUkPZAl5҃ Ɖ*<Ojh{.V0F 8Ͻ¥4@-*8Y)$oZ^QM@PVKjn >GHeJ8j4t#6!'^Go3=jpDO;fPGR2 ˆE|HNcyAIP" DT1PgY:4\dJs]{p nB q]6MhhM? eҡ i1@>A@uSJ%bƠF 1֡*ZҌ8 S9|yy@Z}MTSB qDAa֡lsAZx6C2 $$4AA:|jB`"ԡRDH֡ u#Dj„DkP((h{ '[Ghcj$6uI!ԳtOmQ&`q@#A‘ dT!%@7R&|<c#Zg4qAAΜyNszdQP8Px¥Ym1CHr|ِO "N@*NaN>4Qm>Gjˍwq|ogd?&#*mE oqa6}>vGmn#vSc,`^@rt ^EAz=kEwjƦT 8qֹ-UV/ϔ~VL?E $TgƊ&m'r%s!iy'ƻ&eufth=:ȺyW2JƤʝ)/"RH h-HΙjˉ-X=+;2weG;i4ۆwqb7 :żk>GEVn@3&@r 4Rs_Q! G+DrE"hZ*Hb;N 杔 \-7-*TS=+dn;-; Ut`3:X=epU)VGEaEc)ujv;T= Rc,/Zגt* N!Z!Xsth~k_Hw)D"bfix),.RmE*²EnZwu_HPE*kcJ{jg:=R: KVPhJrVdEssAw,J 0wf}=i1b\#;Dƻ+Kw5[LIJҹ3}y=L|kc_림C7PozT[DeeS 3\M} S{ka1PfbZB m0@>3Zc-ݳ}䔱/=~[(K#d~A ,9޵B I/vR%f;i752qCg^c ƒ.p)_EӨ)le'FO~L & M:Kf sc9IQ0:_@ydԯ)q1o쌪u9d T =E%0Vb 8 K7,'+?kLiXgo/RaNBUIJ^&TO/';u}Jug]^mմq\pIR8$< SJGEq@ yZZ)B<8#M_lϣ8Aq9]#uJ^i%v kr\qXӤ-M e [[XP+qv-at`MSZ+} _88.#  kcsE-~r@IAROO3Rk'3h Lh .R *'qkٚ^wl:TAS(uaÇ҂*zc..wnP8Ұ޿QzZW7A{'LJJDxL=Dh/7 K߃EaXd Gxß:/蒷5U/rfhs#Y&5Q4] uU@͌f%SΪp<mԇHl*6/g('H#gBO;um\2m% Nd9I*1 VLQD]P}p ^W r&#'pZ<šbҕ%xRe|9W"ţtvRm]ơHxSVH}NZ]DfOt,H=jy,/q{Y h) e S'Nxэy]F7. fDEbz| `0gI*q⩈s'ȭN9RSp;0{D0b:E u'Opb+i-A&TbDi^⦉8fbW$P=,N! l\{MRRAy@oxyE*~p3[ CJβNd+-[F}wSF[l(RdӉWN2j+7k`qY!)FbdEjUp,u`͕nNF[\;:ۂqAhStOƫ:IѕvбEy{' F2x]w7C&bū,,_vNd$e@?{RITK%lwiV'NVR'+XGW{%f$1}! c6>j5S=+2#`cIIse2*SI!GyH-c8yVrYq9P:M?RIodmƃ@K2opbyUUWN͂FE:\V瑱O\ $@j.+gbc­ 񯨰xXEubZó!&\% I|LVVv%•B/gЬA+ʛ}Y:T>->$Yz [2?{܉IiҳClEA= Wi=eI٤- )XT=45^Hj.Ge6 ٸ3sW&rWҝLR"i rG\jGC|0+ͩX5)〖AZn>L{"c0iq$H_UD0 LyAGYJ< FZ³v mZ2{1w`ϴ\'$zȤ}x<dw+,BcINaaJ( )>/AaKrZVFLʑ6҅*D(")cH&L_Wbn{s&<</^I/Q9ڏvHmPTF1#Gh--~^k7%^%IFFP>.1¶(\)lv3֮P X$(P }KZ7i*Qv@R2֕`֋MPD:B` ‚Gz?>"͘vC @p)Ð$AGBKT60w &deHy$p{ :`(DƲ}+p뇼D'[5gc[+pR@:OZم̡{ؗװV:su%^zA¼;kTۨ-Y#RpK".+YxΜkC+{Md"θFڸ: QaCkk(\REwyMҘvTb>?8([LR&j5 - [LAΑ!AxUcԡS:*VDJNh2{n4t8b?$ "O#րE$mΡI!@4hq `Q T;OT }"l`|(ڈ<^(4=1e.h@U!qA)nf)B:-z`J uA QjZ\r:gii B*Qw!&v AƠȋxAJ^U{P0fYWځpDTөZ 1mjQ5=ے@'])y@!3$MB*sJDDI>AO5:J֙ Naimmu򉦰se@'1W!PqmvʡZ` 0woNv隻+ղ{ݦ"xXMS67 wNt'dbܼ*<-Zw#c1'*pJLݬWh3ڠ̘+,v*'NU»:UGD%Q w5 `^2Vw S"S!7id')$6C#jjk7Hح`BzG}q IAtᥚ+(wb!LNOю} 趤}=5F*aVTA!qa֭Tdi\f_ic35lT߈%SlG k&٭`¥7>5'.Ia`bzկ{eqT]kh&)P#Jr#"*+bg[{!ŀ_AO52eb{}9lI~d:lnka9ؗu=]u'f75uT,kbg9)KiP2a$Lh]]+Uב.Jxq}^6n9UkJ݊^nRv6I "*t'Ƴ{_Rȭd┙/$'# @&c•|ÉǝmXx4|_ZK3+ٍ얕$) -s^Cƴrzca0c~?.k' IoLx2vh~,V:$Uxƺs IqT BO/a[;o@NjIRԢ-*e@rU{GbKXB[$ UݧT[ov؀˪Z[aRT\#dY<-P+rv)}>ǵZmr%YgzPq^HeiOӝkT fM6[_j/ 2 m9O{~ZDw+mwKs nF^ͣ&d6WS]h1^u2,}u~cUԐV8)D&1,d`ީLP|EnRI_Gϳ(kTbq9{FSE.86Lp H3cȗ*0(.Y 8q.y~4)A s͞Ĕ_zƕW+ ,JI ZxN[DW  U0zTҫ_pһH^" :\BځӜb$srl &V68 κc2,x+Ng§WjP,# _; v7ŧh,Sf'*=r *5Ԗ#ڹŨ>\)B ZNQGӍ{wF gdDG_.uϠmf5K&4(xpg,jn[n,;]-<#үWuCͮ#qJʧ`BCBny bX $es'=jڗj ĨaRϫ}Źmӿt:tHrVK!5 >~Q^rrz#.I%l3w 6DZxh8Nx\#ڄ2>xVhԵOj[Z2~}Uf1M4(Qr{Ƣ   I+hu8ʤgs"TC`ݕJ'B9`W>fX\BΡ1&}j,& *q.cu fm؀BAf {·pe[\(@,4IʲP!cwƹݧiW@[G֟EY&u^dc`ƛkfNL >s\ ΜVNF @(([jwjIIO^t^o _?M(pBuKl\2 FN%3 Pdkʡ3FrKPauXo:$XQ 14@)H~_BZ%DqP j >0E¨ʀc˖" Nʡ*T 8gւO%@&yxB;( hkG΂ 49Mx 9م0B,ʈ\}(T t&b˅B+ ӝacIP;@(p|*FIf}&FY @w{_J@C8 xR"G֔%v5s,t'.S3 !<s_P@H,gƃ[poOP0UqB q&Ǎ{zҰJΈ[&/j !4Q  Wc;1hu!G `BBE?<>&$ۏ P$jG;T3#)>utt$3Ƣ4A=\ {KԄ ` aGX_t_)w I xIBv B([j[&̈́)[9RJj<aH v5HRljMf aa)J4VIjvmo~aaAF?m%TfȷIxpPrS$T^FW>{{-(4ԞP3H)p8c}bx,aQьT-f`}` 5nY$XìK+ ! gedkw88B(O~24ՠE헉() OlP6{ޒxޞ3sY=&Wx-^ς4#qeD!:$(uYy3NDa\<*6Bvr@&*VCo7W5ۇ|%ɫ,PukJofgX#rg͉rf[E̒c^UFGO(#8YP:\sD\[IǡdLJ/ J ι qd8^]\ogT".W*y흨q D)sy*5 Izl(VYL!:XӤM-X #6gJI=G:c8&i- ͹9ď Ք{ó,hbS %jA^5n9(+W%{7{yFI@*W('ڏOJ1'ȷl+nw T@¸w&SizjBvboaPjO? Ɲlol1>-=_"yݒIwk8ħqAJXB(exLQuKo~\ZU#hmC%N<JP"iW@*61 )PA cN/hߢbh& 1]K:*qxv8!TzT rA>WF=KJpv˺R|U/bx^9l'u"\"5I[+dK;A;m YT"J7Rwkdbxg(TcUBNTE^5xEBrXӤIus_l|lpS'Sv$4EJV.i՘.ATR倠G>3Ǝ<_Qf-Ot2$hu!hPz\ CN>)6. cìeβh{QU%MS}7\g3båkŗZR;UwH|CK.[# ZI@k8 dJN-YgeJ~Fbl5 h6MW!(l|B첤fbud1ʮSo+KmC}Paj$<8Tbf̢sTd6 X ªzwzӍXeJiV4R`EH7֦Rth c5s9FT&L-99+RTL3d*fy|k.^kж< 0.,RO+^QC7FL[[mG.GJ 1ěDMlBKpI$(E:O.bkvo#D*Vt45l!FYFe"HX4g!:ԬGh$OgZ} 6O`=I 'OG[Sw;s5l9+hbARo)@f'be# q:R9*@g'/PW#BVL}Y!$@$Ԥkd=8̽L4*:θ~A,7j hwA0RzjrJ[1m'>z5ԕp_j!O( 'I 'IKpLJ6t)qÖ $@ rINChB|b.7-}lh~ R>5z*ȂL PKiHIoIjl=I3`>UwfLjm%QIS5{'a*iJ0>2Sl[CӱB`,^ƱC mwbn*9rMѝO%bíY`bZ9 V!eKxT!7 *P%] "PO`wIy(p,f j\{1J#?Pi5iUKOBr@[vZo:UVq"ڟYt9Z~|MөJ;=/ B{FPa2GĊ:-Mjs!iZtS{ԭQ*HC11BW.,3TԽ?2S^v li>5%np56Ÿ6ymxE ͒xPAL0HTQ%/he ؍<9THB: 9@$c0`AJW:RL5qy ηJ8ڋډ2JAҠH@dzA$ @"AP6TZ"S@J8QA@n6í@ɖˆ?-@ Y& 'Dgu6A+T ]uCYUq9o'r p  ,Dg@ R2B~I9zZ6 NQ)@ R„J (k 7|F%ЩWh^\0ҰbO-AjzT!:VBl`rPΈYuh]΁'U~J1#Dd^$p(tt T &6AlG4`ƿQMf>\18t&,ICJ[O:d+1ͮιGh?k*07EK\_kYG<9 a'fb̼&h$ڻ5ޣ؍1O)[ o(ݷ \h%F=nmxV9L:ăWzgW@ FTk"aj' lLn*|Og!s#d]ILL"gg WTjZE dS➠J4+ .-AA~SRVd5bv]k}|k}Zf6f4(5̜*TQ]*= *-cȽ"6 Ev.LI7UeB]c7mxH''1Z|*2av,`J٣RShZi&Ϋ@ζEC;&n^e/yVY,lwx46eE'ƣ' ej(\ hq%EvuK,EbI5Sh[xS8G 'XC<4:t+F/Wsk tƯ,dR^$ֹ\}yu3@b xYƺ\>_ )!R;d@VU^f8iX5_RK9 @n 1uK!nCg ! RJ'O/j v mx2BRh%c2 JSBV^)8\RJQ|BΖ+JUQW˦J $4(Bg#4l/0L}X8fAI>B_ ^-#y8VGvIe7*_J+w;€:]-dh{-AJ@^u+$v qʭ,oV%Wml+f:6pn%r$̠ JxЖ6ٯCo/ ⒥%d2k2ƵUk$#z!k023k"wS e~SKk7y|@N-lK> :'ƙcsU@rHo~mJ.2e@^𦨭Oq0uE $Ck_Uم8bd>BMՙF[sdZT~Gn!V uYX^'QW )JeYFV5sK]țu×=ܝV7=ʖ)t##T JR>1>E "^=ƌ^!-%`zWG j.FitPyS&D eWm-"8%␮ h$XL tKjk-1lЅ;=qҦ9in/I+ܰcx^\yHd u7;թf$Z39N!lQA[QC0 #Z\1* :M: 5}I857eE+\,<'SvxRRp [[a %+] ! S89~|.>HbeJl ТNDVezW=K=?u1J  6zA*P{ټk80l{h _|>u-)v2fPJ@'&vF%)45R@ԝ+1GNiAPR~+5;U-ྫ⓼l2g nbU?r'PՒ\Ht:p&|ro-N1jyj͆A=)E͍†LIr4cԼ'65N$Dr¼+fb)}d3 񰫚JqKߩݭ[x|HI 4P&e@e(Tч-u`"cv#A(|#2]\'4k:NzidӵIZea s2vF6{݇f;2zIO9ҎR'aqV%!9)R !R$ ͂8*43(&m<+n)3=Cֱhē8&Me/ׂp3'х >V4AݻVb{&2͖uVVL%ٻ)VHJf3ğج.Jc,'4v {IJJbo' )f}r!k=y~6YlogXtgbZD8Du P,TLjǩ5XϸGe6] AJuJ̟0M_>BJBf^Ppf:Hw}m= V#M. WT[/*8vʈLf3|j÷H;.NZ!GݕJm,DܫIUJI=K%n,6Gz<IWES]2~<-UϏ t W%a!Js:Ģܶ菵ҙ@P Lj)?,)\cˊijT] jy_ M~Pm @J$q#Q? 璟m~n{5{ę ͽ:U% A2aԦ^ wDBM3-oȵ'yW]&3F 8U?jiEVy q%Rr ?)!V,[rخ 6H)WjȍIxV'˟\O~kxLhp+nkn%D.~8T SZRTnn?Z[d $$AkN2[LǂM@EJ$sGʹ5Jۉ9H촳$6Iy%[݋ťya&:[L>#>$>7S^ALt'[pb@ IJ:T;٦bʉ3j_4fq`!#Y&}ڳEaNi`eh{el2ub8qrNx<LJ{՗NT ږj 8X_[G(äDl"ڋ  iiE JCyuDqΟBxO`TD\ EOkE :Zyldr{3Ly4t7C7"+@:Hmj#k1Q?*o@8CJvX=E0 h=ڿ%3Ÿm&|[[WVN<>?h#g(pыoh %2f&? i({3c2`2T$:Viid`ҋ2uUd[jutQc=CF'X4%ٯ;)BTb8yM;i fZSA 93٣e܄*▴c$8pУ6QWKkmJs; 9h0¹vj{hCjh A($쌔>K}&VlllH?Vb4cih% Ȟ"iXV蓷q3KZ PPP];,eU:ҴO΃<=t$V^0nlֺOd^cOPpDj:-Ph,OOJ`}G^t$O(A8blHpyHFc;ma%EwaKI[\HH43yְҧ'KWw[(MoC#u"7{*C2f{5HPt'NK B!].aUy{̨/iu50P1 Whq w`ѯaI~Ɩ|WS<ަF9+$$ەtq&g;l/\xZde7"eރkrdè*Y.SD5ӽ 8Ht8|_0 AK ޞ l(KؕAJ=HVBeKn^Bpf3dyJ9=+p0CO(U1dx$8Em7КzlqG8# );[r6rOlˊue"U#h-p?6xP 9+H"Mo艦\q|;7 BrXD 7#*kD=~FY(Js(*#Z^I}cŽp2{tċ]zҸOz+7Yp 0"׎Gp$ףm*2AHuzj&¤j*V$CdLqL񊑚׸-I8'J<Zי\vUj9{ĕ)8~} F[HBJ )kkf5_cᰡ?HZ3ǀG$K`8ͨ1M` !$Tg^4ӗ7.Dݖ1撓٤VSwf4]] al8"%jIޮW5;6$Qɹ<bmeъW-iPFWz| ~wc/v9y\wPbRM5 AlFFu]FBSĞ~[NcT9,̚5/C͟lm d/kܨ'no3<7:U#,POћ_%T(D#9ZLW+o{9F)eéIwK/Rq_$^cg9v;V'<#Œ$-/iߡW %P}>1KK!dt/eoX{lR`ȹFXZu v/ga_ڊ^1mq*s(J G2YKv-vc`)j*?duF^M? s19m'Dt_ZB+&B5bD B=ާcao`tw-[]%oA$Ψ˕Gdx>Н \Vo({>9x^_-n>m|W S|1sÍ,-^R_sj@VS8 tvȯGUKvRa|$iʛ;P%"~Xo -6eI@L,D*чubnM|:W7,\dPvbw p8+qdM R=9YU{!\Rb+d( I&)];e| aq[…}-zhh ûdiJfβ _4'U>ū}lݘC]RˁAVN`MA?e=أI0캮n26#֯$K:!RVͫFQ|)Z| C8Oh+Tuy\CtR()3(rP?:W}D/hqLG~&c,mD Ϲ+i% ^&5:轕ѵ,dm"+MΒ&oAro ǚt @dKf9R`Pha6swT|y_'n3P]I?3\ȍ9 r*|萒ҫE_jJXP o/€GBizEFZhJMӅB"3)XW>[DS'@dvہ4@8SDBm~qHs1Hއ!#7̬8 %Ú/?: L\) *" J$4u0L1E\@:8s4D)JIVP9s (_H HqHTP07 NHFAʄ|(&jc@ #ݏƘ Pe6~e`_€E;p#Ρ IpZQDy*QlXӍq]A Lߏ(A%=(2C\dc774#i\ǝXf'(qIUQ]9OWJ_()R" f'G F ټB̼n-կ4XJpέD@t\w][]u8r3l8Oʳh<I$BAn˓lPOSZD֪eDbqQ]ڇJ^i@6ß5~>JgaqX'˭uQ:v]?i@[q&t"2on0"d 3y (R^C4T"RDۆ֔;j}1U  1vXCϪ~Чʼ(H=؝+lMg:ԭ&-hŧtN+}BmӅYVf=̆mZ⛿q-^ϙJYMUf"z6ДR*XnY)_qK-rbҭ mb^4Rm7 ]),vLlaQ-Te {)l `q&$.<{Bt f;dң"BF%RY4..?@ZlyH5fU!"wNb`xՏW&q$t XfeiP&G rʹ| ̨h B㌏+[1}0{E?5ۏ|_&.5=<\u56Ʃ b\Nd)m'uzMn& Sع2hH .,^/ummr]X%s H?h=N>/@Q *z>ZRSmʵ>ukCWu $Gğ82^-uSI!z_W='Z"Dq;8lc P#o앪bS{;!vpB$h-wK0*V,K eAGN㴣r[mihV?lK"#!Lֿ rw'f:`BBe\s^ ӑ}FRxAKa9##\E@GZ%N^M)fž=**Џy/ dSNZ!{JxRū_Qx}.*f$d (e.=Y*$ʙ=LSPE{{O\K! m T]f0(>+,g%(­Ko<)+ QH'QT)jJ-qhޭg:ʉg9s,Qknkt,& y OJ,΃J{^w JG:K./];3k G}2R _/4XF͓?VIy3{'^տ/B5D8\d2h)lJғh$ە5.9A#XՂ--H)p *,iK-6&ڐoILu+X6x:а]z{ QqM 5 x#EfA%|ʙjU^ܪ86ړun ,JPHT=DtUXnوQqEh:fu@3Rđ2T" 2JؠK폼ÄvM/ ׉UOxʋ}:I_fO/.)`RQ$NT3N퍚?QR9~Fky_\23[yUUaUOձ*ڶ@&NDpg: HΐaÂO@:ڳB -G( H9ұa~(T\d(ۍ#A ju04-ޛ\iQysU㗭FAZoP'O΁G ,lRu ! X aFa0KjQ!<*gDʡ `& *g- Oҋ hgJPCRTH:@kjC P\@b3|(u,r%"CӅ %,sZΚin8a‰)P$ %(*g؅~LnMO6RNnH!fD 'n:D?:pEB ->zP ¢~A($TA&jIA[& QҊ!4q.t!d @#J$_EC.gƁRccÅ ?(~4,) ü^yP )༶:!.<8 ˯@q`*I#d:u <44m4:)SmƺMhq4@%6Rt iҘsA@o5H%(I&~U( 9T!B bDžB ,e:ZP^' E[jJo?@;s3DhIIT S~_Π 9C ٤~xF ZrNG)P6W^Sk4T.;2Gֳv(ع/e :?ڑY?[*-9{xL\D"dO^,\Fe.sHI'[)xKvQ{q:oH4c8>pTgdoN)#n`G]l'Cib`hՔY*tbPca3Q_ᖠ3ΐrkS€ᘛ֝1c-bV@]&^s횞i M#I@\> #gT!. >KT1a qEJ$2te,H`ݜVeUmVjY<+ZӸ9q]/oON3%FC:3<Ҿ͸Krd|-$(uDOOԿ[ːT y` s <֤Mi{)0OmJ\eIWj/ba ŽČ1q`q Ս).*vȻ1m׎Iã2}4@5=hkJ劖lmi1ؒ;h@O5҇i\C6Nkb$% 7`mUy1.[2e&dd 3Ǡ2i@% $xr. [C0Rw1BDZG n%)T`t9e$QOaF.Ru$ mj=IGq6vLBUsTx:Uj={ LHx+ưU/ЅP۟_QJ ÄGZ {l\6noyƂ%dt3`=i OV m&΢UذivŞKFH-@娑ʮV{oIKyfL$ƶe=u5\,~-`+xGg')V\l>|vr-[-3h .4 @!$j<˄2A51Mhm%Ю*vmzteQ$@Ў񫔔!bۢV?súe>$2?xƝ$36{"8VBqMC - W5qƳSoN~*ؠ6sIN›Ͽq7md1. ! F{XH "]C^m{5(0x$$po~UmՌm BwG `gf}-aE.Z yU/{M$B$%Db-ISk^% DֲCiSں>-ݬ:LD'MUѐ1,x3 A[$b)Ԝۂ~N1$) L9y֭\UU 6^L6[ Đ*= eI^쨗ax7-B')gnW )V#. R@5&O-U+Ma> *J>ϊqѻ݆dT-Jt}r`V.9O[6z+ܼ;(29(rxHyD$'?gdIuҠfR"jD{* ge9@H$MlnyVU%l5cf4u-juwG+w/zHmnZ@*  uɤ'*S3 |M*A~XLH,gzUUeiCVpc 8w\/㩰t{!jG1n#j(m2A-T=9=ns;Gp _@*1jǗT6ء# ^u?*,j+Qӳ aJ@n"o#AXZ_,o*%xr.f;m"5#=^ R#Hu(\|xLRb{=Sb#)SsYVH%b0%"I'$$R&)e)0[lqd\Azz*V#v2yĶBױL7k)gƍ}zX) -KN "F9pxeKD0pJ)%*P#C"x5%fwi'aq:ɂ Qk,rnڡXVHJJH"]x=`kmN,,.u6p3H)UԑxJ֜! KV6ެ$p.ōc*HS\ cj=/vE 9yXp &H5W )=R+|j50+6@ИMc.lARtc]9y~556!'<)S%(f60@$ ?vJjާmo*:c_ HSQ1-~QPb&tF![^mY~qQ2 mpyj}Îӥl *$8Zx 6A74(S)+ in ѧut7ώ4BcOiTl B":%eE/5nOhԦ+S$&Hו"ăPR䉺tV9(!)Ʌ\ vsE~$sJ#7ʜĎkW&3\Ft#3J'^ '5Ț2o[s1Z$Fg*c'im'fO5b?V[3k1+``'/ g|W;R0Ng(* $$zPKgjJRpAi}#ƚSg>%PӇ#M!%1*J{ڏUrZU[;m&S!HXH R8k5+[+=ky!rP$) 0mKm!"n84)PwuEt-6!0=5n68+Ǎa=}Nb wox0irPQ 45Q*R1R5+wCJNi_ݶ84qhxBf =0&S/1E) !9d}ktaܼC;sy4e@X$pnU"8#zڅ€$p+;TΤM,:[N.񛣆ۈ`T* P P8:<;xbܜtwa2EJ9'Q%AH1y3O~Y6v%-mm eNB^HkE^7&G^ӵT!D!RI)>ͣFXnwASU,4aSA?H.7cTƷ\ҹ({x7 p=xޟu_tJIQ2NkjUC- %9\TO:PmT\l=Y',ɸ<"RJ12n[[O2QpES%Z?+4SmX7h*RxDW@:GCbŅ+T#MZ ppܩf]<KIQEwtΡ< }뮈/3Hݴ)_H3 OO4{ 9pnEQ͉t*<9',xp;HqqX@ :f$4IZEK )  &Hhn\&]QNöq.v0MW>dNi.J0ű!79Ȟ'Z/Ln쪷cuF?ɐ`{ܢ ¢+B能8a[$ y0lA @1Jȳ]Pmo3`]1"9MFZ0y!ݎsv9Ji糬Cm-! UaO+<]H[(=ƆےTI#QMopm}*Y9f 6 {X Cje(b6`Z0Va҂ĠOMM͡8riԋeն9(qh#a/-)Gu& $% [/O5"v-Ԇxt4=öim;MkD[a ՝mQ?j#L:1!`@Kq*}*jg.UOc;"3]%b<[~&S5亁{8)^'h=HqJ{D@w[/az18‚PUٞP.|GNâ/vWo1)Q9DqԸ[ZaT%6 2BxUt|8L)%ЧTޓ%W=j~OeRnrPC-*;RUyF@}Xt˃kC}ћዐ{I :=܌qa`|=+2*e#meP(S(+yr7%~cy§.;Er6덂qJRЃ)$p U+?r Cy\Ue >xypOnVHa{Jo3d $'y\Gxǫ2d Lrj%(?:𫊸GY[4$)E1DmnIrXe&U2,NoO lX}#T!PBgn}:VW7d_J$LN{ngc %!`Pm2ǻn\#tt^$R Ef-+1Z@dʀu$V*؎Uԡhzy o8c>`HyR?#Ҋ[@6 c'lԴ t$kUAC%- MPxUΤ :DF[lfAY $Y:xJmng9krDwD'HY =Go %*RH̄)Wb5 q* MSpnH(Ԕ6vք-4cـ"`ܨ b7WKh.*m**0@*Å_Q;,1R8w`W> y%϶r{GD19?/MT<؛q\4ogT@OAV%b2bL8k72x@ ~8TjL3Rka[T b<l9'P#>FIwILuT TD4E:N\姕e#&'g^WL{禑Zjc H0-9TA\Y{;s3 M9i3b$k˥rJE'b2x>wf[2p/BWTn$"/vtP*)D^RqP?: 8{;jGrDZQp([^6"0'@Z# BDicB-SJ P"Tmzp<]֧:֡DžBJ@2bc]h~?"Ң! P t:Q.&FƀH7{΁ $<[5)odN,8sQGGE@4C޽BavS:|),$P ڗ^DboPZ:Z $DIx^>Tt3T ÍgZt8Z\ʀo@#záSڈT!54Ά[@Nl*}o럇¡vyFaj)R eMB AJU[҈X*ih"VH2||h)mƈ4=f@"TP (E^$I+Tl&J}K64HY5S&(@܊t& j"m DA[L0ݦ*?3]Ķ_-`ychtPֳvݗ0^FtQfG sέ.F1XVB]:Rg6Fa!D_4X_ɦpZrd:@ X|\$x6AM:oK0Ujp%򱔉KTkq[o(H?UΉ5Fi;Oi^u&h [iT#^BN \؟,wlu:1Rx2o/5³Y6.d^4)YXqd0u@5mX BF&:_SQܢdV8JEƦ(FV x@~~ƘTLJn/h,HlGk y$y4:H}>&E}bF#ƙ0N_)Pnb%I0lE^)ӢOKq8CttS]+t1x kqșlcIهQ&-jSШ$(o[}>>OT|w%PHfT ?/v?)vol:{tMw4jppZ,Y;u va˔T散F'H΂ަAI9V,2 a/@>hYƤYLe@ÜWFTv3=1JHʒc4ĝF~uu.XYHKK$y IvtݭJ/[o8  I:-UKw+RNFK,:י!( &m}R% m` 2}J͊O˦" cq8< Y%rn,E㘧6fgRAW} xlV#N%"2ǭ;ǧ~X5_ۻ1xҦj@Y#:OO.|c6K<3xrBpT l8µE ̳KiYru9,bqkq @΅iJRԢiaPӰQ$^JɦV,h%a,AI QT yRxrZuPn6.3-s%.ADZ9.񷫧CFءu_BZ @# ֝IZT.bPyII SNbX6VxPm{JIA|)cqH{uq{-i)Hi ̔Hc5j7].>en[JDBRT\J ~sonK#2~E'ȋ 4$m"{m\Dtxu멭Pݔj*JZQpxBJ$"C`ʥO`FQ1v" e9 )$$9:ȓ> |u%3ovZF$>H*#OГy]-Y ʶ:qrȄ 'DA֋z vHJAb%XBfbtm#^4gpE0&b/9xݵāπoJ}JƯ.!NF\@<[%i!bu@ėPUL8T-=ӽ %L RB.& e;|e!N%fb q8~ùK ۍqKCm D$I$&.0te.䝉τJ(񤜻K2Zw C㫌eV.Z&ZR~f$)3wB A2dI~=ˢK`JKB҄)jN Nn M0BHRҸ *@V@ҞPѠ'{KȾfdA J#<)ߪ/Ű1c_o jm$APʙ xޕ*N\oB`ЖЀ{ q\kBƒݕ4UJl@67ʣQ Yo/)3NI>* $SҰwZUV2^nŐ 37#6} M!hAT\& MO- [n<*}2hzZ2!X˛>!i4֖ikܯ m'Dחzo3 S.iRIj4#&\C#;Aʆw:ҁnd!Ze{H h8ֶ㆏Len$q \"^QߓR%;EX )DxW.~6-kbf6ĂJU|*)z̎5!m]eA SPD HxSG. ?ٔBUq)Yiԃ%ZVl~-٥ĭ8fLB{2Tms1;.W 3U HJiνA_q oo`;SCXpGL{I8HJdT v{dGq$Yi˩f]IMٛ(PBc9T@xHj-LjAiK!3ۥkI7Q(nQHd?ߨ;OakOAvfo'n1HNs=H*0Z+n'C{ah!Xwy LP'Hp̴V*t֭Xrވ}Z|AJT$k0<-V9*_qF\5'3 L$N` ^ aFU$Pb$Oƴ2*ތvWhOf/'&ĚԱ?%V;3U .;OmvG4*< 4Y9$a6EK Ow2$'L#WOaI*{{ttJrF/ JaJKz!$y -ƒ<HDu&k;\/7w~Oh$kPy$ތ;mё՛LkyW۾TgWVTd` Q*2m-eRNco< aM]ѡI{_K#8ϡ'dge5";ہu2y_cRqdqcTn|lؗ/V9# ` %='&*{9P#U/]O& -H!6[T$yqHFI"b;"n S'JgO%hO{ 롽u;5a̭lWvdպ $A8cXnHw v26>D֎?mҷ7sFݲ`ҡ'Np^2w-x1֙"?:<D(a2'^S֘4ʠ` kT IB2$ d7I?b@*qDD_ [G@CA:ED{ -PY^aD":ZM z^/P{lʀED P JbRy[NsvRm&8sA P)Ί@PhQb:TըqB B`*Kk=(RZgʡ,ha5yϕDBhs/*aNċh y$8A _:H$q ` t4/*Px.1ΙYNqcDž-fo6?  h6 !ſ@ӅFƔU}@DgAŎ(!3Buߥ 4d֡ L(qrf /!<b8%V@"THABAMƕ%FqJ;Q/&H%MX)d E4Q KLGH9eP ƠP.3@':r*0[Wf"u]h5K! ,q4@u`ʗX 9(/4xf(jP";9z:"(y7(>Gҡ6dMoz[bzVDFax;'_fkOha T[`=2japfK`JNo3Íu \1 B{HIAG,:qk^`^h#4&ܪƦ$3D6ay©7gr$AR( SsL-ǞE@ IczZ$ ?*2i[s( 4 f>?ݜ;.zo{ rKnA;q_~쎽XCXҏ;w!j=Q<;NoA IN+r;yp_2~4F tߠm F8LƔ{ XSDؤZͳߠwg$zT{nQi{wg/և݉{:= crҧ1y+JuI]Ŧ9ރ %(ڂ #S> Uhbn< y n $3Ɯ6!Ք!j&8\9F*mFG!]Ʃ ( 6)ifjG(ٸB6]yVhK^Zvpq#g4@:ƟyGUZj~b1R2 HSU,m=.0AFiD DF8KsscډyS$2'@#S>5^ruQҿq[/ 24k[Q}y-i֙N!#x|:UMK臮C;%\chLeI$6U9 qkoy 8b]7ҟ7n,]=l֐JZR  sLδU&^l@X΍O©mkiD}/wu ʳ}Zح++H&RN4)=+oԨt%/ΐB@q3SYv.el%+8gԘ!*+aEU$C&ͳ``p:Gbz[uixl5h$HjNN'aqxWb9 $29FCNlNC *̢Ʀ C+ F- #frJz'=}KXؖՋpI%@Q$s2!R\)٘5I2 UI' թY;9S{ RJV2@:X,RFiRg[pSVFivJ'/XU}SU8[k3Zx/R2 ->Y |+uTF9)K! N].jD^T ,%ISהu?QDH^Ԗ)$I<*[žcwTIdq3(qrh>#K*9T$\wQ5TboCl*@[}=2>\*M;{ T)˭Y(I+i19_a*M픸G cGawd.I2K xΧw'%rI Mo”B)Nk HLؚ18I)) Io>qT)*o ^}`$N"O+𲌋r{p!EM-$U/aKx`LmB߫P˸=<;BM)6zvÊlWC$y%hl %Je1w`n' -w Z 2l)^5\6[haq]BVU$ie{e fI8u 9pz+,Iٸ~УD^t68'-;+Vh0%+fbOI[/]'po]+3].y}c~75ӟ 5G~/G&ԋ^glAʨ D70A_uP̩GRXҴc+q?[Ly&Z0QpuzXZԂ(i?T9)-=4AKH r5z[YM@/1 /q&=te˳@EH2׹9*WqzD_ni5/lE8I:H+L.jqkCVɷwxŠVͱCm !1ʫ.YpX/JQ٨k[ AĤ։aːOP DҠHQS 2jmQQOg^: (!,¡%Y{b@E͚߱J9!}-DQ[*(D: `>1 6ZaElEZ>t$H*7/p*s2Q@#PӀi%+"DB ):$P 6C$#Z6 M(@"ݵHp@:k5)v@i@w !8ACE:ǍF-*b|TU >T0Xs Mʉ\j쭘8|Bة`&ފf˻AL5<~ȮFDlmG-H'0u@7]Xօ~I^lStK ±K<<]/oJln`*R< *m4m8iܥRx/BQWm3e}.Bʫ}{*Z|k{6j"% ZuClMZm 3-Ci* ':ՏN)R+v=9|(ϨT pd@m[Ҳ8w i#>:<Ѯydvy.c%)nqOy' w{wm!6J'BI|tJ m֤*%- C}Ӛ'{i1zȰRyA< jNʪJ".-M@ 7O~ղҖTds#_:ɓ΃2-)3%" awaֻ'Bb! FTR#HNmICd% f1 2|Emؓ7^2d7JOcm=x9B$sĤ*ǑU%;RQ(S-K-uLziz6Ka߸.) 0!%< F᛬Ti|} ^dRU&٦Zfq^[TځU~TmElF{H}JpJȁr:OJӒET|opݎL I*'@+vrkS3q/-%eE$%)5t▛36lm[BՒ\qap+6ic I.@ @Ƣݖ[.ն2œCD|gP}~C8=Ǹ#P@,IItҝ)uT'lw?!I9T'0Rer2i%n;qcҢM%yRH )#Xg](I() žZiƂJs _stj*6Tc8>; aIzk1u1t+klӂiVBQc jBU⯁/lpɔ:e93 X)dݒMGbiok8f>[&egneFL')[TNv-daU%Jm;T6y$A NM;z!{΅RV"H*TSr|ZE!nR|i$fGUyimdalgcqK+m)N =ʖ3*xXɭo,` l%t$Mx =XՈeԫhSe >EG`6mjAZ GkE?PL|3ecqfX HHe.>%!$Xpδ)з+qfPmI UJ7*~DR8L"0R%+m#T7JJjU#6CJuƋBTah\II{/J.1å^[Ij'oʄ{/ro XVpVPVfI;[t Hq_ q) )AyɊZ_W²u?AmdV#R%3{H)&GXd#z)Ay$BIߵAПr0X݂V來=Harv $␠[sn=+2$-}Ke1a2!yT 0Wk٫J5kzx貑6i$҆Q[9Qq5n.yBS\ɱ;Y4R>5v)Y&>ia?$F揉T"[gRK(O |jX,f؆{B"QSJS/ O"m\ZpREpGPZKD2T zUwS,)Hԋ D}Ck) %mbAē븶ʼ~y*fY T?sxڭd٪*mmRx,yAzm7TgJ}3BI)=-NuJ 8*7ω *%ReItu֋v ͜$+&Y]JP,%V m&4kc(vSi!nX!0NZ֘O},6%d^^ʆĞ^4!^gd`j7  feG3I^ !jqV*Q6IJ-,0՘D9g,XkV*i[A'?An$wFb+:Q|v}gq o|IȪR؄pú*QӍ$-62y1F`gVP-_!Uc'TM[2DEQ'D\|+>.B6SQMیΓEf(rjݹQ'[:Saizj: Nmt Bd "ib m)ӏ&g&s&nuD KsO)a*Q!QH)0@2?Ψ,& vo6t+<$b&Fu7F1gi@A7&ջ̹A&(8f6J('ނuHw*6EZv:8O[m*5}lJ3xD$?lTYH &ɑZj:(PΘҡYDkD[Ӎ5<ׯJ+{iY (xD}-FmDJAN5Po#^@Z\LOx΁w|i.cPlj@L?ObAtցaP"C1ơ;#:P=&MDAT ͸\cơ$QrhPOaXT҈ 3F2R>P^SĤdZl^|(XEB&|j2pT 8B8IVAo5=,Z Qnagdo{BC`QP][3Vm0bc lA<g'3PTM/P"*qĈ/%(kw=(i0o~t@Ju(!ajCtQ 3[8@'q/T:Iu('~鿬:۹P#/P=_O/'B I Q!ӕ-qh$y k>ZڈJ:UoDr1Q2P`/΢tAj{$u0TْmBvwsA'8@ ,d6xGJSE:a8&m3D HDA M*2;(ʉACiPjoT ˫)Bx>XH,0$ \*m"<#^qP#)MC2gbynl͸s: 3J]טqVVud.Oḿd<4]ba׳iu5/ORⳬCnɛ8CW >f7Gu9U)TI7҄& jZ]B6\+eHl+p |k#|I8EeN@ /֔f`bꢹ.BJ`N:Ek FyJpRW}9;ҠB4;{#EH'pYb bcҗa!;Ŕ4*G##84MhIM5;MhkJ0GNk|jwLХ慊5)(*wL:6Uևtɭ^uZ:=$oywL 5;Mh11n哼BXr&O2wq;5sқ` *w  J='x@{Py?xGsR;Ο,Zgr<:ͭYtԉ-횾ᄤ\wT*hܖ Ɯ*6O14T82 vcBs_ITVY>D<6`^*Oh>{zBCM읔d$Ψr !#g3bDBg} 9,<,=M4InچXs)T9ɑYT).c`.0JdTO¯Y7[Ј6r- 4| KKo%@d6 |fG:: )Rc~ $b -nՂ%0O8*iT-dL&#qd`( bjaȽmLӳyFE%*"4)3U^]FFZ(R)S=@@5ϻۖgDoWԥ aҟ10;JnNϟ@iW;4-hbULU1κfTyԍ.(@(1)ˍ6B+E,Ri! XL:p^HNx$cI3fJR 2 :Tqksi S#ݙ<9GInEv=\FIJ3{(I,r*,+g )K Z@BAbWǨFڛFdnh9_cJB8P3tqW +sH TʚlWa  J., yX/WU8XXT0$ڦNoqԜ6Y)΢=8cލߙZgz2V T]d?d/Baf#Ue'MuXGwI#[|ǀд3;'Jbq j!$|x|Z|J6aL8Hץ?Q!I9p}\y)W%&;Ez0nMHpf&8M)k_/{9ҙ%oU[E{,!n$W^'ҕ`}zc{).' RiO.vWIo `ˊeىTH1A꾈+$xF`$@{`J0(,2ͅQCCs2! :*#(]+{pR᷁6R9)c$<'ήp|KKwy]=U6BBg U1dsoaCRJJ 1EU}O5,a.>p=oSph{*5Xcg2 qwǕ7'*[ qnl qH)ZB &LB[{T[yNd٤e/ EI-MRR$/$IJ~\ԍ{.{*NC-X "gt. 'ڸ0ԑs˼`MuzS1))i*H"t8uҦ(^acáY;Sd i2%lx[[Eiڎ'f22-cSILp:–~цB1qd05|w?sE&-Od?d!?RDg-/y25[?uѷ kH2J jIә wteZu`J IA-3mvZ,XӯZIaM].+& $$xIux4"rPAP H jAȱ֪%򰸥!xdJQ"[t015#Cؖ\ό* M6(yH"t2LI2nJdb;&O} u=aJ}Wb%憢KN&c[e4SGn=ИR7Mǝ/v?_p6,e܇(Ͳ a$G/WR|} r/JD Etl$/i.'Qdq J#AJ$S}9AVh0KD>#_Ѓ9t:*R!LCЮ~<"}hT H{CH%IΉv͠CŲN6@\P!f&c( SA] Qmh*y$>A,DkEe*VEh_ \ $(4@t-c[ڢ!߈QB ֧i:"B%Nۨ4Qe-i" q&>^6Q.Y1+f4fj6I gsGBDhaHvCy4X-M`Ӫ0^?=Ğ-Nj 7oF$-*[1b1¬AR.u6;m"ԐEU\5f>ڨǑjdTH@{{M6$cºgF\ʄ+ 2OZDU}@I "i<75a;Q4 %% Sw],k?^4&xڎDQYǶ4aJTВ5*)>V"-g)Y֕,^'o{6Kt%; t^A JEtbVV$&ӜmK'ݭ+jvR3ã2P-x70 ʯXbVd\k.*;3jeү"{}GZvN$)@eQk'Z;I'i/Xqi#9L >\oWp6鳉Xc #VizsӍ[+ m{{(;yMV1ׂ{!ճ Ic|$ej-M{Ro Fp>:R<["1uB~/2&-LK-v~*`{/ɪS{:2aR# e6cj}%-aNޤXH? <}:=֙27q ~UF-6Xx |w1Dw{1X$pZGOb )EDhTJf$vZ);dROMbi{-{-PSX( M{9`M|ڬ';\_cҌ^I}Jۻ18<3H)k&?>T1ʓJDSn0Wy<_%ׄ z"o iIknZv';qQÂ'@ 1&M"Z|.m5Cf`CbPr:|ͨER$3‡4T OUQWsD;uC'(F ̣IxP9qBRFзHƞ tVmN)Kn!4jAִ;MJ厾Nw!oY*!%GA&|QY 8iV'`nL2V;2QrM>5'҈vcL  hmk7j+Hǫ$nF o 9QZ[.Gu Un9999BR;$@@zxϢ:dA} / `VOw ?u*pawGa=t)-J8FHV-/9"8Sp6\G{+ D:?*cޙ {ExߏAxVrA{'l/veaq`k8>k=9p'iV,Gj@moMr. J^N # ڀ$xƤN [0rp'x1N@e&UbLqҵ˒IN:0FI zFa%*:)٬@2J]iS; R6۩0Hôf>xM=ncn $aډ"/kS1_D=ݬ6ZXɄnRb=M =Jzgv0aXMBy R?y]_Q5 z6[O$ z𢲹=\%}H;WsWZJָqDzاkt䓴7EBm0&f9ۮ=FpQE#v,N$9RFʒ&84㜶.Fӥ{ )f;B%qMQ,bs0eXLقLR-T\"/ KU~t!㦓TG?*쫨ڷ}{'u}Em B˳|,[Dn_D/lFŸd #[x>_5{. aF“1*F\c_Β MQͻV .%Yu"<+QDM0Xt%xe TILdi7@457ip&rDj1+x|셥]9ftQ>?:յErT*oYC)/ :RݿZ+Q gB #Mͭ6;ZRjoUo ~S}Hǒ!Ż+#5u[R1aeb"IKq+Km(%>w%NIOfVy wfI0<|ԣ⢯> LLaFufBs8>Q݅6Zc)О}W<+q[ep)Am$Jd5y>l#~vF`2Ip?`edOv,kS+͂f!nAJRb&g:h ؕN Ǿe#nd1M\.X8xN7^)TyI?;TqO.F1[ڋn'[Jz~YW:`ㄔ.sNSipjKm8dbJRW QT6[+txk6[5 ē$BG*⻣x;`~)xqM`p|-J ozf?Ԁ~bhws 5*3U!6<ſwiix5\$EƲS/N9J!D7m<&8KӔt4eB`? ZʢAZL!)bW<# WJȥ;+JN_xHe\.e6*Z+6XjU6IۥZ#B:622ȯ:~=k VaVJb57$eJ†}*cES :2/Eio%Sd<|i_fA[!ϭ 0THIIGQNJ&+"=ObA? NN{t}A=G!)%Mw.E?RW?#,?2eLk  kEvb<'4eZ\(3"2紆nq>\)? ޡ{Hm>YHhv&uiGT&#f/z/A4R~6} o{KՕ6CRmZ<{}Ɍ:H2wqj a.??~BQ'`th~T7x9 ٶr?u:'xὡ t_LT%;)i8css h~Cw]`>t;Z$;E̱i^`5؏iV(A;P$N! ` G+QyG SS'x5 >3SC5$Pt) а'(Xev4HаB~DϥM #NK)̲̊nZV`fT^*dx1VI O=E*2'ЊHy[,cXY5B,j>1MȚA”ykS`:AZ#+N?@B?80HCOXH:xCN*^PyXGR%b7 =g)0$ *,LC(|.I{P =xoB~Ft /},4ʂɭ Nac15!+=qʩܰC )p diK0G] &$OК78ґa֏=F%`MK AOJ 87 :ʧt Lpi3ځqQHڷdZsHXEX8-֋/@jBReNm3'Mhߌ!w**wRa։-XE^PdMhaPU=).6w %1*)^ at|U*+ Jf*<,h#a /tօ~0hwS §t .TE$190;AjKQY5=XD{Y*^G<D w2)L߬@tWNAֆ5Gʇs"kG߬<ҋ"kC8·=?u^;>SHS{A)@ةHwل-WPNDևx@$LǺŠ 9FLOZuY H!Fc+Ț {cBM(,TcCdք7 K" T$MhY2@eW;Z:=a L!W@ֆ jdPdMhooA5;B 畎T$N Vpf;2w=é@/lVDHg w}xX$+MMu#\w J/(>i; fIZJL_O=Zw?@C!s){R(g1^WCĪU'ֺQ$\nhnĈzUy2i$cԶVog $|Iq''*}NRZd3x6<>5NLհ$pXȢ~N|kqo( \J %CIS*<{Հ+,fȮ%tHJlU˧reHĨ03:Rg%Ũ+ FH{hB yo̳tx.Joy5v)[l^XeAc,NWn4 )#,`L'X++4 m bV\ww>/Nv\!8Lqڥx FX Lq<:Ѫy= F9'hb4'l9@1u$ڨ.zRbl8 $AUPNؑ;s:P #yɰAzɅ-OIN2B@U[.tЭzi[݊ fQdeLœ$SW?bZOՋƱ8e.q맍/w}#b m9 >\"qyN!8\7ڍ'>&O(>]"qM7 [ >uUSCv8qnA߀:{KʉzUd2K9F~8kzW]lk>ŀ%=0Dp3ޡĠg{^#(e.xr׍['TW,E݋b=0l1=ʃvaOW*ΒFr$ |(/v !y.a{#E~]X|eY޷T`٠q4~'mڊVpPFI_Lӏrd[N)JzxD}a}K_Oswfc>1hD[^7K¶׫:pvPc_RN|OJ?H~X{NlDxK7ԉo*G=÷VsʶSʱAZ_Q=~)pDd?pXKF{I# w} *y*{:񎷩zvC@݌*p,g|f.Z UuI4c㖷erIcٌ(pZH#Jz *{&FA˄'2G 6{tC3!Aq/%i2 [ĀZX֧GJvskǕSZEo VaDPH:{*D/E~YBXIdqMHFr2}qSoJ7Tu\ '[" 6(SKP1TBZ7Cj3 ᕕHu2OκњNAi&/VQ/RP4_YA$!;"ā~?yQ1!"9ڃa##g-z$@7Cg PFqgݿ2z+DyX^I<Iĉmh+2[HM)=Q".Us@awD7@yyOL5Afu6;8nK X ^W6;ؘ J &]? iHSX J=Щ%Y_$Lߝ9>i p,(:j&IQMU~DI'v66TxfoS\40 -NyWm޾ڶ%$4aSOe$A){)iNO#p.od6]-sڈ{'NW*z2h9!&gP#*MCShRn !#f`0-6%W¼x*j|~DҽE/R }vw$6MRsu! /Ё1#MR%.& !PMKWuW`ݞ !>qЙ.S{JHuM+)P2ʅM~DI"ƶZ{sD@kg-c$h{E.~Hj!T B&ya͞TV$b-J\GN V <#Mm2Uy%)횰RxDp(hV?M!*Nh uq6-R-Mʜ͍GTM o_ݨ7:Hy%kZI˯hJ럀--s0o-TNKz؍"+X,!Ar'/(_ .s]?q4=c ]As6 B2n`px"l;ITLr3;+36JOȍ!nq\&/g)WJ]xI0TGXҙ9.| Rc70 :^ )K*-iΤ؊p;wSTU[݌)EX40=YE?\@ LcMr'~c(m=:-|c E@2;@28 ]@JN:ֽ>yЛR=Oz}d\_;' Fl Mz 鍵4RF` F76 m2o-Cx-%-2<9ձJ˭݅bgTl<zre˖1//v*HA$8p" @oO#E@y\%d8k=9Voa@LGh*9P g5Q 3rۆRڲ˒`1i’Ƣ6\l`Jx"JiiER,^=͢g֊N޽BIu ' t5KQ8JĹ*m~ҵ"ۘJ؀&xp5Lʑm.3"`I<0v7RrL(J$X[\do@#0A:VU&6wQcg\v 3"/qc[G>.q[BUGJ#~҆FagM/ $ID07}/P~%I/ٳ.]lsC/Н^˙YM7_t0'> S't> Ґ _0QmLW pKDQݦ>fUö$Z~R8I.(iǤSrh]X2&R"O=П1i&/l()HZ*OĿDyg eLtsK#„/٣v鶝Gگg-.#TuO?@"dzv/y~)"w#n~%9%J$4@&x^_{hvqpuQKD=fX\*~%,Hqb+Tx˯}C<`O}pHt*~!G:o!7i'7hOİHY{λg(~%GRtdP=aqvmOIJwI%KY_*?d$b mJW$N eSG,߳3DYFh~%G8dhW~!wHoOSOûS-G NDJcG2'tG( ?k/$N Ti~? h}038'ڏ$ S2&3~T! upBKP?0iWi^$t;L>*|Cv#!gOC'v(ܜ2HY5p̏ $,> J Q;zCGq0wRf|(Cq+H|jwDun.3c7J{%;7={=*."wHw HY"G$NVa $N;@@>4?$GVaOߞy:hɃGX܌+jU'&7vA~B|VS4#l(RTQNVa?1GB "̜:T h;H=mw'v'qbIBh{u{t+':@NjTGyzcBU#*I!J2([ҙdXxB$Neqڗ4!)\(anHbl-*~t^izB:¬]+K:^ %|/IK:-Ru71S~Љxm}RB>5[c%@>o}A[`ӁYtyҺml9t@-ĩ*d=2߅n3%{2s[<48p*h.DǁJkoQP*m TGyAN wSt' h$3=Mb>LcՅhH"Y$7,Z1y^q3qB{Ę$EVXg9K4yb0S!YMr蓖%7zauh}ݚHp k*Rc/g]8~%%H[wdz)Ӣ Y7P&2|K썊ً}>%'CLkkޕa(t>i%S>/m;HHr4V5'!KK؎HHf5PV]wѤ6K2Nf}w&+xR|GƭqX׸v5-Fғß-iDeڜҒIJ̰n[p9ͮ"R6*  )sL+hoRr )##rt, M4f*V/cO[&,'S΄+x+J[I)dq*+V7a!<硦q%?Er k3«#wNV-+S+gNz]"F6Q8E "A+2ݘ4)դFLi>E^b󀐘lF k*fWlAJlI#a^A󿎱*m dg{{ς2 DOd ]YC[SĖǧ#_ܳ]1Cj3٧Qt67}U vHJn{Xҁ<{4M P7#"u^2!RIq6Tx#l+#wGib m.4{Mm;Da*<9PR&^E;Gc|@DZWX(2o/ro)w9Y)GNH}{npPܢwFHGME7gx{bo}q\hqזZYFŒ%"#ևrdl`o%$ۺ 1*]^“e\per%Ĭ.*Fe8S;׉7UrN=`Bއ,@9S{^t]WLqC!Sg[W|[c{1f'ݩ/@kgɉ]UBd(NQx[Hm{Չ\u\9xMkz-.n8-)y~)T }~:Y v+)CG:/]淯#WxG4AAƚK?lJ&o9$GQкQ)J@ zLMN!LRH0H zyPMM ^fI ~Qx&A?(5(MoxIR‰޳CD%5 L z} SK~Swk9RD@S6+z**" (XG6 9?ZdvrϪIqs99ڗKؗԑŻܼ*%Oj8^-{͈R@KrXTxנV! fMz P~Ebla%JPqr(b} ^rj혊} /xruo9/iX I<_mb/e*o~_7_-%J&O Q+*mg-D)d1)nmK%-pYW3z,d_ u sLicBvDZ~TnE8nSM{!9ą0gE[;fv$Zʍ3=م]$i*dyUԷU-DIr\6& ,tZhWFScj¨-$L4 tc JxRkav[H .;;vlAQ[dԌPa:55$6R.cG :E+a Z/}F/m;7xsxy'3΂Iu^kC^Уr߽M,mFb]/uг[Z7O(?: $4:7)x>wNbH%2#ޓb7z8˸fz }3~)ˈ\s;yTcN :BK&ÍN>_=cnVCo. :ddρ){gbNL \;[ŦweM-SV+)rw^1m.m".>qi"RM~ ޶!>*()6Gِfŵ-J?DyZ:iX$2ևV[TS@@d$]S">T gtFJ6YAM~1VhL9-:*~_No ixL #OCcꃉ*L$OtNw.%J/7˧.72`yahir>JAvdb☘H(54I,>ӱ* !(UHmCnJ=bn 4 t_[R0SݛGf LR^?ޱm{KļD5GِfĹ+9o(:d3nM IQ {Bf'}\N$;ιiqO"wB=Q܏Ə;#>-&Bu&#Sz+ڎ BSrd2z/6)D5+&GbQ&# ^4ﴬRA8vw#]h̘3C E!Bn{8Ӎ.>NℐQŏG∲:hPS`Oxwb~Υ""4xciUG֣9l}bݿ?ZD8ߴ c%.&Sw4߇;ghRm?`ASzQl7t/zħF+,Js$r? /+SGA%" N[KD}le;`dB$M3;RY ?-*w 1ë7Xz;uƮAv`"~TE`%T% (wa_gNfBh( +c|Z P^1$\ k{mm*w#◾ؤOEQ{堍|踤 w1ҶӚ2) *Ah lPđLȃvV%BtUc2i'` ( bV#bKN<ήnRي)@ 1xHGSq(* yK[9ˍhdt#]lYu2J@!I?[9E1M+(!^DxɣZŻ= [WCx5֎»APh*T nu$UЉP.LE)n 9NDhR}Lt5DG;Pq6Ӕ %BD^mʜ.L aҔũA$D*'IZrTMk:X+RVkԏA2eBR`BLf DVlb몆ʜ{JM,+ oFp[AJ)&H&+M{(>U%m9")jd| ~ YMP\ <8߅@+aC(6<)0@3KD䌗9鈗R@W=*-g&)h/LiENCB[SѤZĎQ֑2Qiť\$]B!Z0?!֔g'BrESݨ+Dp'BoҴZh'C&lfBDD(<)](PS8uu |Fz t!GR#A[vƘԐ @QXqG˥i¿v  ԰Q)̉5Zt=X4:bq@%F$ۅ )H[–ckU=)b )h-H'# $yj=ZxCP &$Z/p/ #A)$ĐdFҭƺ[ i ĉ8Q\CP2A˛CVfFRJFGoM`v i ǰ9 GH Hʆ@@$I).2/ʗSmqd .8'DG@k|:XOR[8K%"cEq]) JQڱM,aB!e!W<<)h>[P$9'2BB~>9#t< =1M?bJ RI0 sP7L04vTDZ, "I˥Ƚ#g"o~M~a!YBGqH@$k{ނAl{^T@5R:op0ADocmNɂ`I?Tx\t*V'6nil m ndgNz"{Z +@-~"^<"=p0tf!%gO|"Ld6ŗKT6E:#QMfK_R*p{HBRU9D`t1Rc{axRQ J'rM4EV\k II2~"nrA /&P9¤$CҬSlꂩx#^{8ӄRFo{C%jmrmzZFw|H9JHsδYUnVaK qYHE`UvXB{X6& E-uV6F%MlIL'Nhp=AnHs}cMȷn)+)@5( NY$c2fr{$t'+ cOnL<65 cX'>: !w5Ηm£]I{Іҭq:Z*SQ9O!<~кvEDFC7>|G!rƧPۯq.(=X븢* GL!DžZ{teLH'2ճ}=*"Ii*Y 2'n"Do <| N 6T Wf|Rw ǗǍfB9:#N\^=Iy4F'131E>[DzkNʾU Ϗ @ݯ ({"A}M+l@lx@[Jp0B#J_X`.u~ťaä$!&@ikl,\|ϑLu'17')RtxJ QQipLZDHʎ%/P<;m&GTƒ=@wL ǯDN\BoTNkQ^㭉4*$Ɔ3G܊8):qҥI Ћs$38$2'Y_nJCB-(tt:eE2UbNB9!$5БV6 ΅j$bqwT $D=lE$\-ng,YckX259Lan[c̸L\@jqptmƅi.13~0v%R ` p1J{8JH* &-ҋ+F!8HGe#4LZ, KHZ6}i??T˥RM5K`@HrƹkܿWcVqJ/j+bqiA%%9oeS5"j:_VĴW& 4 n\K Jt# OX)TSPkT'ʤ)|A+ΝRV O"wgc8͍:(Du)iu;{Kϛ0GH^Xq$ɀACAѺkXG*wF漒2xɊ'v9.)mGDr,Ajwp$=)p XzD9Iʇ~{8w-jcA+;d\n838P- **nbV%l%FNb*/@=Q>S’`)HH:#QT^J[̞hksҢ݀oDo)Uȝx$hAE򣷨P+"G kBVUMKؔ/@x5/bi6rf0tJI)FQH72UFR#PxPֽC ԉLg]`B"%WAi2d2Pi؍5$LAItu/RiN*{ סh;;,lG Z1E3-8 `¿*II:'kM{s \i:RL:r@Iu6c^z(9 N\:?K@Vu-rfBS!yRxEORk͜PlD QMz^çf !*cZ*k/ЊZsN\H&0j&DRxyPԀ2[khzm3ț:m55 4؂gpP|FTý[Y SѴ->XSR[ĉе2, `#2QoB! $CH A0G/: nRB^@QrBАADȃj㽎N"b$y =(f2&45!hٽH8h $FR" jZM;#g (b ozjG$! )  [ԅg L~3A}H25֏}l fRרS~œJJP$爁چge-A+JLLH^jZl4K!)29(~tu!Rlef Cn) I3IsRl)8t(ks3p/hХA yo- >Rש7]6~2j*0 "gAD>I7&8Plj:4q#@ܐ!eRĭ2=G;q[9.(嶶˅ԴEco"ZA#OvQ߃I%>T;B2AZmIqV $A<ԈZ LkO w$*w!d@g]mDj'.Ʀ XjZ$)<-7MHaS Ĩǐj.HUќuAe04@u΢&41X7sRAӱe7Q#AIKA1P;hJPt'2HIvGuTW'FPrܦ2NI3 a T'XG-$ΥJ) @3i-.<%x6Pjd+hE4APs eB`>+ߐW"UX .~ci6SVt}LcMQo>) =]* cxPj7d܆!)RB#X䄦6+.U!6By]"Ȁαkq̅ OqZߍ+ElJaYԢKkJd_DZHm-gk)͙)±ɫ56aB/YS )Gӕ"DSƙ.]z,xʊXa0-m'Ժ؜7C 2(OkRy Pt %bh¦UD5 ^v"b3f,f .)ľi4HMdD SqL})'=f(q`*jB"CN'♷8ʕv;::@VrvSaIUgB|l2 A7V*2j!yH'Q:ۀW=1DUL|?Ju58:G!>ު4q8\ uqޯQ_)ԀA$L+i.d!RIcsk{~N 8bmm1:tVHqua= Xq iPJAGqUROzY* :`$l8y|h{\uLOƣvD9e@Ay|*pN6£C(PZiHI*]$:K'I=h-<'}a1Ir8 jIyAЃE3;gby-##09$Q>JEq4UMu[H%FR%2Se*CnBRoG.P,9lf*^VyjhiZl%brA S )A$\ ң" S2fM…i!A< @](9 ZDq}Dń4*~(N`D-[#{dS7d0yȵ6O҅% i"t(mgrHEKMP<̟J$G9@ץ-0BbS N DG.]h[Y7 xi'%D] @n&AY0fcIeH[ >םJ1 8GZ7d l@AĜ): ߅Z%XMH !J<4ah[ĤF[*RBQNiKa֝C)";ړhȀku%GӴ[Wxma7NB:FBBS)ƧEHBW'Y0"y+Y7[{EtZJ5;bCM"LAPRPm:S"Oҕ1ڵBq.%efkxD~T9`J}moJ}V) D'3SDYm=.z[:jr8% Kbͤ4[ʒ_ !I$&ƢqILMÄҙ%6Fz4c;B<}zԺ#{F"""45 {(9  / DLG8TnDa@)3CzQ'm-%_6k+;ByI/}VAK4m6Vҡ>'*Äj@2GRšG[Q#ÆyԫG*tq-lO1{xxTka&yLӟQݜgdPۡpj$%"S7J,>pXb,(pUp ʼnѢj!MhzPaax~49g85|f(I=ǻ݉:tV%Qih~6$Tx4ձ^˩)6ӏ#Cj}# t%*JҔvYo Ǎ2uC9@)Z/֘a3Beq~U.];u.:5V] GOΰ8e^\Q9O)[Kt2O )RmTIFǗ $(q ޕJZ/)\oG RSI€@MlC”>&z>3ՈRvmΠiP@ cwXN^pn+rP@lLtowm $MnX#6lmE:[J9T~?*~c"YPBRxB-8[f+^wUjAJqLᱵoBt'@9JOz# ADjn*FՕ[Ѝwf6!KRMA1S~ZP=*+*G*HfK˥a`j 1,mkMF6*MZPF Dt~l-˜6#Ɣ'\&ѭiIHFPp5RBƠ4tbMhaiq"D():Z bq$A'^(c1'ʥtDIũsTeP 4Z=e[M;r4f$H%!%S{_OԌN# ~QMjJ( $OR&_3uQx\GO3II*"v01Ҭ;EtÿF )@-Ƨ!JTJJUiÁ'^ :d!%'YEi $iSr}=|8g!`G|tb $@Ђ8Qkk&q q#(ZR!!I#"H6mSeiKd? %{ )ϒ-ǰ*\nQEne ؓ*E$dI%AB`x#sJLT}mps ? r16?VQ##Zg",Bܜ@TM$JwV4b[yJ x%0" )0iR oĤ;lŢLOyQmG(}]ԴHӼM,8JDlg*0Z'S #ݚgP;w 0DDŝ2{jx,? BJٷRu6S C؏gxJ q PJ gSxrί3B'rF_tSFvGu^*QFe!! l8,¹w'S `k܋oqq7=3$Eiě- 38S~%2w56-$@RDPBAUbRRT9?h!0,T)l@C)JMn5# Iݻ%:vfATyLTtoq1N( c١1Q,~5tE^b$%@*EGZy^op`D59VA-E@tP&x N ݌b'a!&U9sO_٩߮<&iڧ~tX?Ĩѱv~;w#P\tX;{bMcߠ$'{  eDu#ޣΈ%>ϱGqxͼ~!dx*x"fxyUŧq1~b$Ce\e$ AXoVυ2ݖqV'):ILN񱴤_0cJBPdrU8n6Z^騪ܲ*udqJP76!%](Hon$H$L Z3L2zx:OS7ER&c1&`[4`u _3LtK$aS\i~}*uQCuJ**qg^0ڜMuƳ,@OVu:@)h6pn`\@ רU-z!lԗHQdHN^Psm]ļ\JL$jA[QXW68qjti{kn)%+m$PDN[C) !\ Y4$c2IlH9ipWl<ƴHNkQ-,0N6'.yؕbY}|mÝ,d#VᐢՆ\s2 <)q)̡ǏKiOt FsM+§U\;jq}Iң dD42No+ _⭊U;%rʕ$&9Ut ( *%TK!\b], M#XY%! MX련C-u4QIAؔ#6%2u4JM^b]m0`EAN"9a[Auky$^Ax/Ka*3*Yq6H^U 3E:#V &\btQqLvLqRJ>RA'M=ؕCXL*[AYָ+&EAQPIR@Pn<*7d >$XŇʓ,A:44Y8{ k vj7qG&ĩɛ5C΃"Dɰx #Z@Hg NwEr4W:ύ. YI^G|2"3E+ 1QJ(O1ʀO}0AM-PC-rLT,4GZfxt#`( $Q"GN*8FK"4l% ' 2vkNm4΂ahwpw 1cR47D;qLqQJo*#‚ "xhha-MZ Mg+T9 f$&!f Ӏt1D%;0T/R0':Q&ۆJ8{>PNxaoQNM˅ԡA yi k(]0xp< CCaDp(C{'$xѾ)+L66 :DβzxRyj&t2ې4F!DI&&?v W' 2z aAaB:4?ABG܉ߥ-BTE .O#JKđ*?Ǖ+jg[6we AKb4'B׍m΅LQȢ,$P ОVl.bH6JfPKs @O݆ @Z)Vt9 s䇊×TSJ O)bP :ͣS] 4!Ă/&y5>BX=(Jwh!DQo`cM2]07є D'Oڊz#U6+3AI{[$:MTM{A9I#:{QČG+r>1 )Aܩ*|8{Aj];DB ƜgHrD > xzWt]a &d'lGǬ#@`7u󼂏u+ TJlemᚬqXiPK Í:@< d[xP (PLA|jrd (p()S!a|!)'[ւtJF$l3M@P-NDiBGÔ7ҙ04K᲌PhAт&8BN,I )l$W41_0h `WT s&$mVɈh0aʓ'*x(0BbxPPUI ¥sA#]~%X$…D*Rl8&SqxQ g D|h4֠) Lq:I7,:Ӆ^hc݃b*P>B;mďJuNk|xyփ=,(cd6P5rC dȅz fx@[RMBuY' x'NNi"vA,Kj$*y9pXlhmƋ"o@R%$\FcQP)Q p 5U4Fo6Qk 0 Lsz }L%Zi5ˡkA '˕@IVd\D A|J!io5y*SAA)G"²YON<*QvDȃ^%*D3k$23ԈTm7FC4A!Q´Hu2Fin:r'Ҳxeh&"T(Y A\ ||6A3>6gjAxH#P4#Mx;HZxӡYBNO*jD;% W33ViFSW% :XADs =j4Aϧ1T/x qeIZ4?\ԢS tN"ݜa[@\("/#6)CC܃9RAF$uAҒA̕M IDž /èOhPlx/<ŗ|@ԦߥB b!#CaQ BL$ 'K£QSBJ A( ̑#PY FAbT$;•պr:m:8.GԢV>,1Cx$e$ q{Tb"L(~)N(6Ie?I>sLĊLI5( J9LA ԯ Ѣq&{dX mC4x JdXqjQ yAB@{"LɃYϜ_Ѝ)8@Uf048p14Y/r*Ak ݗQRcA P. (p..z~("$?:4J :[$R8xkÏq*Z=w[B qįߏ3Pv/ JCJL+`h ziPN<I֥ZLHc,tPW3 s~EBBO=gK8YѴNdPJ@&T:qҍC8 u'4Q6b'.WjPlإ #5b*Nx%%W1"?*8ɹPw( B|f@%~^Lf +|@.& 䘄{:$:hFD ˓#TO?G"OCo98ʲtixg&Sx A!XdN-jQ MT3A'HbĶу3@h\$ (_kӽ3k}{<|,Wj fO+Qd> x[ۊ zXq_A:sDZ#dJphd=2/zUn#&]3; -jiX#%nm׭kăO-ovJ7J ťU8P ≐ؔr ڼU(a/q!*H 7D#€NN)3L q٠AM@0ԉ֣ RN>FB@9mB;Pn#'QBI < |9TS=ӬIAA1rqVBy5"t@'1YP#g HEJ%ujlA@<5*1ș"#<%rz ?/6s \&htHA*"qҐvFBh wHE#S3ѢbfH3̠c݂:P)Q O#MBl2yP{~gQD`w :qn3"QLm5(;P$Zt}'H:ǟZCQ@ǗPZp|< )Wj67 [@ 9Oupu:J3@nnLka1د, ~4{酄A kǭJ;\O=NQ!甼'Д/@4⚔P>:J)B٤t'Ê+2#)맍J!"R<{M@+. ?u%gm)bb"*i&ox,Ԉ3yn4V'6 Rw8yɨW􅴤%.*&j:`ZJ?=:Tɨ7)u ^ـI4Q7q$r*MBMd:,W-$eS4QmVw#R@54P0ɭ4t΍3 D,(idCS^h'8(%62CHltmԋ¦Yfӟ>s6=0P !l!Q$?GK%{j!P">1ƦYm24 ?J{䘿v@ ji%.D^ g8ᢒEi%knZIK;N!>$m47p -SI,40xyIciG-P= $Dg)Y$N #٘ԢX1ht9<N)xTi4hyb9RbSR3|yT <6fSm3k(5D _`߯JKMjQ ?NQ&Y`/I= ! A( >QYËY+ I:t44l4*޴4΍RdFg?8t1G(!#I *i%ok$2MJ >'ʦXfzpM kh`u"ؗ0Ԙ<鴋erO_vtŝ `k˘UAc+_`j<(i knwN:OM$Qę::g0REM %e*Ƣ&'|@[3U(l& ڕ OU N+~¸@QTR$[L-m`<#@,cQ)iZۼjBq*=:*wdMs3iQۄs 4{ؑfyɨi>k1ҋP*c:O{itޏݓQX 0U"<"vMC+Y;j:k؅)BvMgmM1Qɨi^՟6ȟ_ҧvMCJ|$'~}MN욆SG&{AğS#݃QgA݇Xw \QӥƆT{jY6FVa:ȑ4K:rJA<)BT5ZDoI ?h*`T:e&dZIcځ3ޔQb t> _#H6> iCH,ӡYO.1GHlRq-"#_ %ki&HIcKڅ:~Ski%;JI9d~44ůj)0zDs *|BbǡV$NS4htmJm ˅ ԛɃU:AbWTgi%#im4h#L$6?<(P,q[OO2L%Nx|c4(ftD9L(I }ك׭z sGJ%sj%$"yˍBGO*:jN]|mC6PT<^qC5BҁQ!ttD'BAd!$MiC pCs_P ˆT &aʁhAQ5xILJ8*<J =*BơDpAEt¡iP "DSJCújPjMT!6*@BYȍuA@O@#.+/DC(TXu٣D9A*Q,VlARg&<ԢJ6D;*<~7DLJ%&jQ,NZCyn %KD%xK= /BbyǍJ%+#R}MM$!G#ԢXoRg{R?J%})}GmCI,.H҃ge_[54Yѵ:jiDQ҉go+M(tmWίZQ,M:Q,OAէ4iw\/Z҉gqW+Wīj54'hji%Vv#:mSJ%U`SJ%8ՋgWqz-Zs+JsSJUy)PHuDT P2!y~hPU*jB?B*<=EB "p;sDB-P-PJuB=j-PSABv2C5xC <CtC9mDQ@"2D<ڠ*PlZ:[֥PPQEBI=zJ%Ԣ֥u%Tx3R$(u(t?RbPcjQ,<Cu\ J% #ԢYԸt$)D9xDݡoԢX>D'F)`{ʏBgJ%N-`19jjԠYXGԤ:1$YJ>fYZ44Ό{҉bZƍ z`yCI,ǹ~M(%XTx҉gZ֯SSJ%8TxIg%s+t4YYcDIYJ54K8Q~5(w1~4huKwI3Υ+*$rBc:QwuCǼoPIC~UuCBtT!PZDt!5pUp$< ^tj:'ʡPJ*>f"u5)P -hҁey~H%Z~oP"mF2~fE~fiA(ZAMPơ09!kPyT! 4ub Ij34x&GR-PpAIA-*E0/ơ&O*#ҡ6>f ψCwjquxT 3CAPT!.u-BΡ=#DиAFP i>tHu| >#A  N@ C(KơcƠO *Y?B 3PT!sP¡DxH6j| | #@'Z:!bqPT !>bGHj!Pyd{{@gd! u&T!;@*BCzT =PCu! !=PCzT!PBCvT!PP6WJdAmH.P'*XB VCCx;U!B+QPCkP6D$P P/ơܷBY)<|EB ]ƉZ*>_*<5y? sACD@WoJ n=hDI,|(N,i@(WPjND'g*k@E@P~@%Z <TtA`T Ρ,GBWP8 >stream HWێ7devUN()R"N(P.ڗ}v@@-Vq]O^O.Ni:6ރ~x<1s0Ad qF_0ņbp1vۂ#~)p~{c'L=X, RtEpPU^\ڿކ}p{ YenZ<)ĂBA[PfCe{7Y%XʪCn.b.{H>Q xՇ4"h,:*dVS -ᢌMKLÅF HΤwDh=|I]Jd'[Ik 36$Y!|UJAC=0KIHubW}c9>lRm*e·Kbh ;gMV&B) ƻ-diC@X~'JU)Fs@6W6փ-)cSvqaӦ[EjW$xu=h(Lֈ4M/%/hf{^swDJo$ ܥx7VvvRbtq$E +KXQGʐri⣶ ᕜɬH5?K匌uShlJI tj>҅jbﬦr_m5d rJ( Ae(ԌX>&J#P<\i=[(f|׻0؎_C v:WǍWŶZ=Q$36{^n\s\`Ow~߿O7?~z {u}n~WNLR  endstream endobj 6 0 obj <>stream JFIFNAdobed %"  &)&&&,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,  &)&&&,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, N   e!1AQaq"2BR#br3$Cs% &4Sc'()*56789:DEFGHIJTUVWXYZdefghijtuvwxyz !1AaQq2 "#$%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz ?ŏkk2!lIr= `$[q,7Is!w%e Yۯ d QϠ$`9c=֏mlpä@\gh1=t?/Š0l-(ɲ_)&*gH,#X(ϕH ~|w_+wg+E%O ^1-~C%gL?D}At8r>MR.ne 9ÄV}`%u@zb!P7ax 6r8,==1_1GqicKULL89?H aK]^PNG0Ϥ)._ yE8U@@C <asRp6';FH Ő@UG_(k!Ok<Sl<xV Q_xl@X)p04#V~|`#8Ȁ=cIZA{ *S^7@@9rXN ztAP@Rxw'@H<8@N;r*߼Lp_g8= !=M(4xA=`$\?Rp 'AW% R?>QD84upYQgl(-Sۇ((&ُ/R^q?/ $+&-^<-lw^QE@f,P])ӄ1@\ſ9E= @y(&B2/9!?%8o#c~^_1(-FZa9l#h < +ZB~Cb\N 񀔭6ٷBo$b(O $^@B@n姤,ZúJ]ͳzxh H < d|`=4$g!`eq闤{{#H[h1iJN rxӄǀћw;@P(  3\񀔸Ol?=>R`F=z} (&6ky@xP;7oχ8 {<Ivie^0)l{x@H_GI@@Oa(,~]= ,ay@A e(yӬ۶ t,M QMh ( g(d5@zwX !na`@XLb4T {@AY%9} =T ~sXw࡯8!{וD|\~nn TǸ>Mn'4CmEk?K[X 7}ɽ9,&~ ]&0*Q@  r<˿A Hg"4ńh.iWcNMhjNK Ӭ_; 3eΑ!Aŋ 9'eBq`SqosC PKyDNɚzsC㲧 >χ9ʄ6sÖbI'<9Wg;Þ 49kp/xr*}H<^Zϳu&Y`\}bD38hh@z E DA^=@z@zZ =zT賊:T/K/&!" \F |8>`Y9p~K<{Ϥh~p$@D '. '^0ް@[yP-alCW $1 *Sa %ȀknKH@H^._%6 9l ր$x ȏ3_IK[ m@H8m ŠNPsAr?e m~txוХ.) 28*ܑs%!$r?s5cp*!WTؘ 3idR X\l `p$9וtAp,_tZgyr÷hf~~Ypj-1yUӱ%|C&)e%|INQU<r3rfK`I8pG6:; T%ŀnK9S7'%|V/9JV—0(-,|CYdKN, qf9K/*h (g͗/Hr3쌹bF"Dy?cKH:~ZR)Cyr<蘌aL#fLӾN!A5B/ٶ } rӬ=%9"W9(t%9G@M Q!^Aؒe6p|3NEi>˞ IF\t0g"jK}pI{9q#4^z}p8Ͳ9ʅ}D~#9^crgSsVaY`_/=9VGٔKn=}r*x8@`ln[[#^OINH>JH@4<9E9!if@vX !? @9Xe2B#&nY`"s}DRj"DB>Ƅ:T[HzC:û=&O JlNykbr%_dPNNA,C/ _RZ!9ӑɦxyi lkx^3,vA6=A c,3㥢C~ >#?:E9?f%la(9UQH)cIOp9 %ķ6="r+3PH/gCyDcHrr5WCbK=hx}D949ӔEIHΧJ%.P,9UؔKU9ה:h,j9*&Y RGsIFt̜H0 o+D^P8RE9Fa*l 3F9Ӕ:J@Tgn97t9!IHOhhZ(Ҷ U| K6X[4_;{B( a9הFbhrVP;$X4NUda`Cհ5 P0h;mD9LXE1+Is<32bca9s[ؖcFb `.5p5촋v="s.%;%5Ył@'KpEҔ{/ݤ]1 !.}'D(2Y'OIrƧFy Un[},=I2\ ?I #`K3yPvbJ 8ε$򋩊٩p){_ˌNc l4K$*f'6G.raDŢsݒ,x&V(r,E0l=#6aŌ9DPJ1{C9MXb k<9VϗO ^m0UK&ٸD1MIcߗ]#\ɉLvw8˂ S,Nd^?uߛePӳßLT}@N̸RiEo+r0d&m. l|}OsQt<#q 5|AH8r[Bt 2P=Auˬx" D@HDG&W=0@S@y, ,bEB/ r Amh _N2 +tx*0_ $A^BB`#~pT*AH ql9AQi5gh@x%AM$f}" @xYH,3*ĸ9`,E" ;7 KwR'(fohS)d">Csx%_=oyD+8qJZ |MI6<--xzDXFX O|@PϺ󀄂- =<$)Š*(PN r6(I6L/h )R/$~Z kkf8 ߌ_h txem"R/ϼA<6(łpe|B HFE詘-8 ~Ɨ< KǓ9_g9J9d #=Zn!xe4hA&h\asx*IH :*6$-g 31cuh[8!9(Ys`KibL@C)0 $Aixͥh 7BPjd+6IP T9RHsAyb ,,FEY4)!!t$0$R2F}94|ys}t]TH'eɷH֡-+#mg͢ DP0lT): b+Dឭ JR{+lje6 ԰Ç8)MΛ't-p}:a. Xj5 %@0g-}< ,b8)z@-f2Zm˔3|ER2n>AGa&"b Ba8"# ÕOm0 $]13A 5ۜP*!$8C@+蔳YAPuKd2-DM*!@H-g#RRrAlVn L6=p}H)9A(h?%H ; eC1pI{@RIT u0jFx' =ȖnjҬϗJ6\LNzәӺ,ld),ys9O4:H#oɉjOmm'&,! l|L v!e B R*֩}l&&|;g˿,xR' @9"J!QB񱄻lVsF 6OCaJ@H7YP:pĵ'ؔ0u5% HK5QSv~b 3sgLAItĭD+EVe:%JnI:H fpbH)J :Օi Ė`A"i$p L+IK]S򈊍B'J$aY76<:R\$;dm1AпϬR$Z"Nb?D*蒒q$ĪPJ/E K uwIURd)õDK(3* $1K춎m%LO$1gy5[3##(hɘ5$6G2g#\ ZyA9I*Gl]3P h) Z -he~"b?|eQQ8Kkd[.X 65g+-1e(9$kw KYD߉Kqb3bLIrܟ(+UPVb ]5axS S‰hD\ cCB|a_hUI7YnoB˹Z$)IJJ~d'TԒsבRIR@C" K ?HH !0 [Ed\X]ũd=c*Չ.wa%@,K \ALLSX0 G]IJ :mrJA'+jtJrl%9;xr‘5$qAybvrݯ`-*YHfHCBɤV}L]!wÚ0zp2+>fL]T\ |,S$"aӀщ{"IQAF.SRE17P 8lD$-x܉XT{ѹ KwS(Oj#ȮV,7!'a3$T ,@fnB{>2&N3F:)f6 |&Z'e'"!B[- E %[ Xx%1U"vngH)}ota@2 k8r0#ЗA$ Xro8EŨb=*(H*7ݳ}-r 6&iJJ ;$EXf1dB5!A*G&N@$vX5q,|1 V@y<ShDG( 瀇t&b|!eYXo6hi4A$MrL ZbJ`cۢ4>.| 4ĦB>bI:L7K%B| 5qRK]ǔkS( 1WhDž2't>%T&ĦY>HĊբsCKNi.9 bEĚ5=s3?:Ú&+KN$?xD'<1cO1xrhKדy'<9SM*NʛyÞsÞ֧m9/-TPZzHrK=$9VNY!VFZCC᱖}bzEY;bݘ;0%,<鋪b%kCL`O4ǧKJp=TvzS^̔+_X֣jT(f ކ!jx59z95xG7= (liHoqgE E L8[E .zix?ܔa!|#tlB8qumЕB,¬)Dxِ&f9eMٟ Cs)2 Gz,2bZߜH_`dFBe3ݹ_-bDp˺J,w3u1u: R.f5֒SNrփ!L#l- ]od2qIRQ=D]KhH %M`G饅XwTM.e~ )¢㛈; f"B O1X44K tukLdm;Znhb"ḃwBb)S0LI)ȐDPĹ`Zֵ|u]G¬K(*ʖap#SH4)Q q ß R1D ّUT%2n1Y^Jkknb(02 |T0}Co  @IJVGEZ={g7%lHLr7~ Q7r;Z RH`ً%N w1.R"b`&h)1VrpA{qJjE3 k1T0)%I6 $KJߔUӒv 1t1ʫHf&xc09tJIޔQqIU!OkdQd%C$k$qw jPL)#Tퟤ@gC+.e)3бbᨉ$rm$ osizu%*Rwpb]*1L,rG,!5Hd Ei1kH 'ҧ Y4LV k6zBA^'XU"`n}l VH&`^o)D$NQyj+ODgUYJ֫X\ΝaʺQqWi,byFjLӜ P &p=1d E@L~qIc-/XjcJ8#GF_UJ|弴 $&1qxuTR`+H䣧<#Kn8'z:[2&'GWpu./qQU JP@../a;oQBH`ӾVvH1*n#06 VJ'EӐ8w@K|~aϺ~t* Jq(v}p=M mP'*-5sK *Ln߄e[7xA%DX]Xn>ѪȜra5Qdu^:Հ8K䏖UW2Re,^g1&cUըnZٿޙZ²D' qaf?haē1|kT列zb17o($Uh*B0.}A4+^YMk 5JU$QGA-LEDIekK4[xO-j!d= * wkFv<3+ɥJeӃr1cDiZ0d-&P^@7G\gIUm]B9 0T#z40T\5oj(e0v>p2 l,M5E9D@RrDDLUJon=HPC)G|A!ˁD|sˌEhJT$17g=:EEgѢb@n9>'i–&%8/۠W_h?j9TwVfOzZdҕ.pNaj)&4,9@(eG ϧTE$jL' {žπ2iP@1=xDN 5ۇXz]^ obavKX#~|'$apX?KΔAVˋ!OBT&KmCPٿox$+`Ym_(L%&{ d'NDrl a,a]Y4/=3J78:^1>|*`2[XCf%pߧZ}y9b﷠ Yf`2JQbFqL&KEe8uIgpwBsvaTfw3k~?5Yv܎\Ʊ{"2pM?Hą3$JMz +|J&{[1. CA?HYh*({_.ʐ(v".|2f){ÿQIEŲ,NI~q<G*l烤\?IKH6cHy9$KĞ ³7Al @yCGmN{,CfGyKOĤwpc C%2*ўٚB(IJQ4x(N6$Lcǒ;'%x'Ba=$'N=xh}xÿQycX7<8 ـzpzgfv7by1ִ2e@΃݇F]Jk_24{(hLΊ"@0Z-#kBiiYdOohBʫM0#EX-:zhYrh8 qKsj!LT-uK$~Db'.#ɞ37Og dMK},編*Q4ˇq-K(vn(fˬM@*J>RaN*ӽ|&L ) 6e8g({&.7|zdWvgGF3t[(ji 3uݴ3FZ^\K ![7 h>TN*ȝاW;"dzJ?OW2' 5kaE i##ZjN/~(' Kٵx*ȨL/-W; x1a-"z,emԀou UEX MX>P5vж8=YX'՞~QpR+ I 3 E`Z x NI4o`&bR4ox4%W&ߜRtRy}`1R(2!%%*er6BfRAFn-4dhq 2f$)! :ZJ0S0dg&l!vAo4\Xs6{b>4sV2Q*jՈ!L1JݣݜA4ADžWoH "h%x .l=<<9?* "j6ZLrJMRY#<)&6W@u NZ IS*S*~ %+xeiEep I5G^pD$=VP%R 'ʑ= X8")'%S͞)?^`-:t]}`$γ!h"/x1ɚǻSeHw3E'$ ) ͔_61菔WWTό#-E -3|#~.J?b7E͔RI'!9' "g{IQ-.q}"`";Nk5BqN96Xf.ĠJU3ӤLyIF);;oC5VEZDUP(RNdَ&&*"x2ԓ+ 1P0Aat5qb+7ͽIQӤLYÎjTf vOLD8*hĤЀ~Q3rN &uf͞HwUf̳Qg,EB>ZĿXrfb\)S^r 8U=lGԅ]2;uԁ/v X\q׉n: NVp6:*̞\8,.&)RZu83}ي ݨȳg<ȟ{84l0H>04aTQ͚dBMm!=2dfJ*)94bf*B"aGBzC<U*do7gyŠ$͖4JPUv}KsH`bdQĮE^ZT@AR cYteI!f>Z^JTstQĠppEDiFZӸ2j7FYk5no ӨDF&ܹwtT˛RRKM : D%Hu'[e- -RAxdt%b`'[3sNU.~34Kec|Ӱ=,(\w.QirQRe gv3*u)QD wۇ(^\Ă ( &^˱w&0S쑣f$Y@:K>t䄭+ FwxK"=SE> R\%^LNc& LP0ʸ:Aj0M2^DL]T3|%()TfX\[,OIQ6=arI IGe@3pԴ夀R(9 #= 7K`ߎp^*qFs.UB7xURϜi qfA9lU,2p@3G:$IӾ.Tu$j [yf*z!!GWOM))V.Qy MK>)K{#(=Y@ĩ"Nu_: ۴|"+WF;U*6ԳD]LoFdF?`.*e˸;1T%̱`%ɗm'Oݢ^TBNv `ېD9.pHڋw"`fH "]tCV*1c T˭5J3U[Q!1X;TqLpDOH`+2rb2"+'[@J% ~ t>.MQLf 0ZeIK?M%wB<R"Db XLĂ (y7 󉢵TbI){ˤE,^0Q;/( 3٠$J `O<yH=" b!%4bQe ܟs b$$-~0/x[!(#n7 KR5*vp*D!K7.^ s4QdI 7$v@ذ)+( ;Ի_tQ=>M67`\qoWXT^U8]c(*wa's&e;#xeSH}`-Ia ?f s'@Q-T2gn9@D>fF+\y9 '}`*T |Lq(o % 3V*ZF0ʕDb7W ˙$.vu5Y2jIpM7t\OAl%ߣ-}RBYRPbs//xse!mzC+JfTq`K 1URL M%($~ ?Jb ;+Q?B<]#P/ XMH%ٮ-/m%I(C(sqGN34/"4|~1ϿWGR%RVǴ3DN,(\´av!#i*Z[ Hf{u-ibp8|4+ H R0p8l"`\\) 31C^ݘ !"tqr%_^Q]R/1 jH½"eJ7$ O-l-1DNDNAPޱBuԥ+ 5"'lMC`ȭXȭQjoG i9-GYusY+=IJ)yL P%$dMAUtv0JwnTc5FQe2|1Z7# M8PѯЩ\KGLE-.㙷7^1Abc]K!$1%/d{FTUJp0e} l S%F-ʮL@GLI@} Po! %H$6'[bt8OsR0G@YJ'hXlN0+>PÉ!8:t$܏sr( ûx1ҏWP q =J|{>q@ n?jk1v D-6&,0J3jPPu+Xi.wd9<;_h&c F 墑u):TkPH#xb+Lat!xn̿X)#E)G@6%NjNސK~ 2Pu CPI*3P-@]Rd営\E%?+3cRQ A r, -_2Pb?K󂭼8d܆HPNdE,yƢ C4!Bv0V;s>U=mL3?ʱbDDωq|JDS2BeTI:\X?LGk'\ϼ4*82  (=A/wԽ"Գ8͠#-J^"8oQ Yb*A+L;$ωjfϘ܂>:Z(%8b{?;;4"Y @%CDG(HV$vZBV8r`_DZ %bP*(NE Qn1A;xYN|SI9-"Q,';IHje!́,uIXHqVKƀJMD4JoF9U YbnB}bz`)90hjqD- > 罄@ X.3S 'FP͊$<#R.&UR = ^Ϛ_4/! >TƬ;$'Ȭ&O ; RTi?$/af*$HGd,ޤƠ\&JdߺRX=/5:p$grX6j8!&gi؂PԘI 7g% J٪U Ek1%4!vXF+ x@E*S̸Wp@6| AOdb9̦׼gΘRrbW.|9ۖKB I(AyY?<@e˗˃AҗL)*)IfziNY+ i'@ p13c!V{5̪2N<4 (SMP n s{%r= j;)Ĕ.r  V@! n$a`m!Rf@MPN`dqG2b0<"˘{7DT +1&JdfM<j4KUccxӚ  RR*rJJ1$/vx a~1ES0Ɯzh3  NRv8 /g^XT܇ 4jdK*P 9 ӿ@ )b]T))bi)"9Bs.BS%7oTT|?d\t%%1fг:+#1Mzc?TT|)qJ2,?> O- 69:FU%C_|WH馸n2Yy\ѬGB]Z11ӁrP-0|Gr-,a$HJ@ *~`s,Z9wHRqA V\HRT7HGqИHcHʦU+PZRxºT H<0S+M4 hdX(XMtT\Ib'=EE`RD-ko/dtLH 6<ܦI1\, ی^ʔQb.#;;e&rql\\K{ RdlD^W-#GF]j:?QJPvG+q*`ZzŚX)%\E3)cas~&!}*aĤv`8ZmbBrCwյ^G e4&XFLgbдqg.:rSq>ّМw,.j4 7F3ɯ*JUd kjcʙ~/GfWقRD|8_9^5l6X񎡑,(%-v#>yF̫F@HprZqU$@&IJ-#^<'P=w!Ⱥ&hnhpZ& %GLChH7:XGP!Krhى#ѮHık;勹ĔV )RcE:RʠasPRF&c]' TV\N< SI*dP."L0 8?F1xꏠ5!%e6YG.*S?"#撀~Q͉!*|$%$ۀ|UD Z%rKu$R%F PEWh֦v@s ʬI13CJM\K1$>vbI{qI]b&h %DlsAHc8!E; 0DH<{9FUݭک) X5sT m40pA<,5 cx׈D52r% \ĤUbCJrV9b p%(N>Qh(R0|JOv%ÆS8PKL@7t Aa&DbBoDM+KN- Ov6eR/B 0n-1~XX֧‰|e% AA-Kdfe*^$aSvI(JYVnKE‰"ئ߀( 8)Ի}Z,PNNƇ`H`s1Z0(9hФlԯ%d[8ʀ=ҳG@D~$9f:@E$(,SLr*1,I9ư C >@RZ08T .45˼lʽxFE &0@1"hRK$pRԵnz]J TJ÷-`9-W@B@JNxB<$]̢D.uC94A7tۛI3UNQؐow$/й[OG$(l4)E,%Z$$3DG\U0eJTAk?em9f,ֈ #ބٔI0 M$dlʼn*%!/>r\p=N$ S%X' T1EC"LQIg#ڪ^ZJ,HHq'!aԓqnl t \S; p ) $X/hǘïtJ H=k#%u6d BFBgL|`-{E&}($*6CaG"Q87"Quh7D&3RJ3GԯH$iR/a`:5%AIg XWNX|Xޔ$$ 0@`9u K/ RFpl3TR-,RK@LT} KMXij-ag(W^ JY|f$_¡2Չ%j Sܜ.pn'o5#1ad"X !9w gfbit Aum%v"W;RB+N\ OU>uyW` RX 94QIM՗tJ\ {ںA*VyO]3Ia9$#8fԲ?ds)1j'N#wj1xHTH)XP<TI ^=#ŕq:1+ c=H쒢X 5TtuzǮvp8i|XsƔ-ۇ8+>&>VYxVW"BDs-qmU2q\wŌB81H>Ovpg<:8|.P%eC<9ch!Sc\eΝik\Rde O4;ٵ5!,qx%&(1N@s\wgBfmOjRQ-JسNJ@Fˆ:|&{8OI6(&#"cJ鋚XBX i͡"]Vk LAe3\j4kDg/1y ]Zvq`er@Y\ʹ0KX|oxu6 Re>%6&M#K]- w 3"Q8˷ԕA,G:myMR H ;N^}J&1PmcX&*•}ϔhU7uJ#eH-*"a~֖F,kF!Y?J " LKix]>o(bR#3fhㆾ!W&rdLbڱXg))A`H̊;v)jr {SeJQs!?((!i`89tZ eqTŃP` , JX1!-bIa߃4p|\JRHwzY2ҕ$ %4;׾{ 1IӥI7A{VV537"`l >.J Zjp1I^)?2%W(~WB$ٛiIE47\~=@vR$1]WQ*ɱ iDJNea&5gWaaa~<  ti0`]C|! &ab@X*6qΈR2^PQ8.Uީ˞ ;F - 5cQ\k8a F.xHYyZB5XR;MqaY4- SV4^S(h=$1@`;̨(7m*:pgQvnOqB d/hPSg~\$S3;D mLIv Mܑs11Hb]\H ϯ\#9rmcJlT4\hQ2>ŀ!(Qmٌ%c 0nW6uJu7Ԙʘrq-* ]Rt7#b/)ݻ3QPw,ys/La(.A&EPߐ~촆Ԏ0c׍h3E>d$q`\ًPА@~7kĀh/?"q13p,s%yŊZ֐2״ ̠wFBl3ƐsVaP 8¥@RIq!-Vj/Ŵj ȩU*#1ߜBmZJ{"l\FyG,':3F@w_b;T]4l&&R@f ۶r↩'a%MVMTĀTsHle ]rX4flpsTl8R#PdZWm(+(˒pW Li*5u -»/g dHcM$JX ͜a)kRW+u[LA$p Y\Q7r_4,|˻CxBgub ωh^x(9?AˀxΘRu!UB d}+ JkajV URS7mLyx 8|sPAPY5O]2JF!YCBg[59"J߬OYq ɿ(Q4$9Uo@/J^AjW.9ܾQfMT7<`RL , e IS ";yX6NMH`G@^Ted@o8L{ɊGKrKߎz@(A=Q)~'IR'-^HH1 YDX0| ^a7.#E T[6q"2&4;%Q{sJ~$xtDV A)=)i?eNIA̬og-w}1 Z8_!@ίxf#8J|@c'zXbBL|*bnx̲͙E&-(+)!hg rrsYJxxJ`d2="cX, T }"xFf@*JsqNV  IgR9mZJq%Ak^r㒟KɀbMIJm "d¢౸rDT7d;5OE&%Vzf_N,@xDҗlc;ۏ|A30~H.n'~ȘeC3I?1pN-r\F.ޱMu%;T K%^9@]46l\x9;y@$a1#AJO2n5Qm:8 OjũC;8Rl|\3Y@rym%vQW.h J']FڒܜǥG{ET5ƀ"Z(Rim/}J\qtڽ=cF3is0ks<#p꒼atrIލ<˶l39.GǤ@`,S<GO$է)tF:ŝ: Xf}y@*%* Zxn匉fG kjkAt > F,SJdӉEk|%6r%ec*rJu)(uKnLc*R:XOq~aǞq]]/-#9VeÅisP#4I kf-Hq"Ql(@(ChK5؉eG5 L.d`w,@RIy~i aCItzFBl{"a aM"F!Aͽ2 GGgV*.}UD-r))UӔRV~ = P $9Dh '<haKXiQ`L! th=ް§ݖL#9fi7|'uT̄.\" V(8v׵Ta!w19$a>!Hjh$,orz0 ("IhXŗЦG @ sZ3jS%7R{p,di6ҟhS B֯dJ9.Xgn RJe Ϳm#F(K*ѨoѤt%Pٔ 8wZHd|Ȅ(ns6aibXlIha@ : jfMΙDlp sJ鈇F2S4Jq*%)ƠPsA)J'32؏b)9tH :AzJca'%@$fpzĪ5'0QHRIa{jcHfF xTE̹{_LeIUTXjYj"RV[$w'T.)x$pr9!bDґXܔ @Qo1zIMQ9hVb4,\_1I&3EjRB)2a]Y`f|+@9&l.up2-:%?WUMh* ~/}^2X L$="zBu,,.b"@Jٝ#s*1›=5NudJDĠ"g р5OrnðI=lCɝ6 R+ |] د{h(X3GB\7IN_'1P+jԾ Cf00Yd?=>Rݐ,ÈW$hO)[(@"Cu;ӒA=\ 3\̜0$s'L@J{#3rI*1IL`ve9JlP\܇F(/|n"jRI / 6J|bp:^4 T4]E # &#>Y?=c>*"i(Ȩ􍲬ÈPłh9N!H!TpGhS*5*" YIa%Yd,sqA cx,7jȻ D&2^("D8` Bz!׊RK_v| %=tAIJMĭW~U?heSz%ɴDRXOk+*M(*8j="cT]y *b`2!%.:Z 2-*iHh E'6$zJ0Os -Ca.k Κżf(,V0MxU+`z$egD=bT!~gvqlHev $c͇%56@)&+dm*4綁"$b ㈿8{pzLѮ.b\TÜK2/u*mA&hd$\;rr+*głl2!D࿟wL#P-*pv}RHVؖ w%t]͗wjfgyqpE~%SJ0Xtku|~'!\Nd:xGe] \0ʒfd1k@@ cXxd٘;H&$ۺ IMY@y(F/UJ7tϲ:UHO?I\{(MtKNcZS 9` 7hhZZ) 8FyrR%@r”K2ahE%x9«,&@AlLc#Pb2:Gn-3 (.C ׵B$Ɛ܉·:Zػfn4JAqĻĕJK iY5>B 2+@D1#HzE21o (FjvG+)LۤesfIP9[ntB.I8N\+H%#sbxbjKIP{hXBzd(R\Y) 0pAp/ȭtl4JTy1 &֊e- %[ʙ$Iި @hEU` .1tjaV$ G=sGnKRaqs'-31,i5XR;E/HikI[H&MWŵ `9UӥPuF(_h4ԿX@M&Ta3I-q- Ed)X~RQqv91G,.K*T{%Qej{F":SV”T;:$9N'wj8(ذKCu2 aKȒmqRNO$ #0@hJ2&)N/*׀+$Cع>@0L">%M!3K%eKQ2G(Onz4gSO)R֠BSd~%( YFi)ea!J±4 NbC.836!粒|˴`u&5]@9RFYAkzTy>FhnJ&YJFeJ"$CFժE:щ vy ٣#Zx 1GJg/M7NY.U$M͉2z0XsLXY!id^ֶl^+ `^9Bt*Y@ #x-J`R~<5: `wVXS*S-*|JL*aSUm-J Pp8T~9$ ZIi e IN4X^KDt&+,8>}‰3fn0|ູr $U6Rt$.Qن)J*\HR%;D *CIa jrqT$~HƕNZ&f%Jsy3AY2L3>|!"yR֛Čā L8g~,Bdszqjvӧ:Wk>X7f{b?2=OQ)6xfv Ϗ^i )x/@f1VpQipopbJdbR3> AT9sߣ´kgOÀ)8۰a~+ r{, H:.q@u)>[yJU"`T`vdߟ(cBCfCk{DT)+Xw "9 J" PJ+*Va!iH-bGL1\p}h=Z,K7h@ 3 {GCnJTi9-&93ISkEBthYE!Ƽ7C#xhTۥؤ>O Yu PCʘPq$PlӔEL]U!3YuWin>F(䳞hҤ.G#` gdtZvt>X wp2 lDV "VDӲ7>Y TÇQ)pZ*YL`\ =vZV̓Rl;"Ǭc[bR ?`u RA͍L KQ6 X^ +rKYhQ-HnY? *zNw+ 1l3s}U - JeO =LL.)a1>`_6J/r:i]($;$A#SğD^M!Wvl Ζ,rMiI48I)OHڅ"i9{vX"A˨@ =l#p Gxr Q%LZb;"?%N <4h0C\sD<Hh%=FVm~f~1GpEr R;YkF9o R#xO8_ڌZc.ռer)ִr1J@96Rtz*K|X/ :;F ùӠDLI.Z1Whw#i $b.uלhN2Ha'І86A塣,=##*ywH6%O}ѨMRՠJʘOXHk[Z28Qd<ueIR1'IZm@}!(S-jYkt%L0,ZqL)QA*P JJAq}HZXZp^D\=@;E#,sxEMVDgg>/T?! 8{xEcOxT2A@t}  &go􍥺 L/9@^L㕠~<#wn3*?$υ⪪N,͟穕U6:{.h6kB֩y|>Tɛl_o ĹE7t#[!~K.mzB,>Tm5% ݐx@dWHٽ@}`\=9FR[PC4RC3A9Vz" $¦9-Zϯ&B%-\Fk3L竏hV3~ P1G8BJU\:1XdokRC GNQܟG1;.VۉEkX9]@(d#t?LjG/1wsU&O-Ɣme99K o8 _:U}^.KSޠ$WVT N2 >a0"qWL+Hb_Css,2BFJf ׈޽Zgj :$7  =a:I8([[q"P\ĭL]151:H@#_1j:srSi01gre2,H98(hN *Jȳ9CV,\ .dW"~Gt鲆nC9f'E Ոzmo%֍q1vI!gњљI.{QI fdT$$, IPQq0x CL)hbYXI) r1%{C1K^PIa>,- f!D48IHqTAI1|Z'r,@0q0AsTDAw~ʩqP.I"2YJ9Xʱ fY n]J]{dLfW 棦MDwȤ DT%TK$uk85CE$-wcH͊bu_Ũ dɳ7=F2ьKAOJZd6trz`2HbGGY9)I9>93J9vGJ#CC% r?&4ig1h*ZwiP&N @5rRW`/(yvX(^^v}$GsWҧ(yMH" ZYVOJ ZBX@,Lr*LkeD qGa00:hRx\ÝSkcAIprPظмiJNt#*٢XarHIUx2؛;,ZpÏĐB8ϨHN`:2 ^U 6e W1t+]2pz7*MK4hXm}ADj׈ FhU8a zJ0 XA3A?+?QV 2*JP2 K3햹@èg()U58akwD ΞgܗM83HotP2 KJTʼnRJ|Khi-)_v쉢tc"hLj9,`󎁚YK* 6= KT%$8mʒ|"rJq:uӳP9E JV]:*j4 shor~~/kSl@ 8ɉ:gm &S8>Jzu-.u,%8-AҢ KJA .I=/͞ ,͗3 >Œ,GQ7uҖ>`Ĺ ջ9'h%@x’tğD a+#Z&ly(̈́vTtxL-D36cyRmfݯ9젰OkAMIIAʅ#D5dсgC:<6tTI3wE-]g'Gh 6zDa?~f$ >O΃>ܱI$=ǔ9)΀DB48Y#<`Nc.bJN=Eh5 %/; MPV`JWa ⎌3>9?YԪG/UiqBԩY"{!h&2[ 8!X[Q3T߾R$}h1}}I"s$5T  L[^QTQ5_./;DEUP_W(ႧtUx#/gLH~<qg @Z P:SaԨnTRyx&a)ALwbNuIDS?grеi;T@E+݅勛_HjV1$ЗgdAlA OPYɇAYB*X\}9S\~q\~BRJlŲ}`SlˬApHcasҖ.\@J&JGdl LH^d,tcj "T